GenePrediction:GLEAN_5035 Details

Name: GLEAN_5035
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:168099..160905 (- strand)
Length: 7195
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:168099..167450 (- strand)
Length: 650
Type: CDS
Source: GLEAN
Position: GCSC_142:167379..167237 (- strand)
Length: 143
Type: CDS
Source: GLEAN
Position: GCSC_142:167173..160905 (- strand)
Length: 6269
>GLEAN_5035 class=GenePrediction position=GCSC_142:168099..160905 (- strand)
ATGGCCAACACAAGTTTACGGCGGCAGCCGCAAAAGGGCTTCCGTCAAGGCGGCAAGAAGGCTTACCATGGCTCTCGACC
AGCACAGCGAACATTTGCTGCCGCGTCCGGCGGCCGTGCCGAGGGAACCTCAGCCGACGAGAAGTGGGAACGCACCCACC
TGGCCCACAGCATTGACGAGAAGATGGGTTTTGCCCGCTTTGAAGCCGGGCGCCGGCGCGAAGGTTGGCTCGTCAACGTG
CAGCCTACGTCGATCGAAGACGATCGGATAGAAGGCGGGGGCGGCCGAGCCGCCGTCGATCTATACTTCATAGATTCGGG
GACTGACGGCAGCGATGAAGATACTACATTCAAAGCGACTGTCGAATACGAGCCATACTTTCTTGTAGCTGTCCGCAAAG
GCCACGAGACTGAGGTGGAGGAGTGGTGCAAGCGTGTGCCAGGCGGCGGCGGCCTCGTGAAGCGCATAAAACGCATCGAG
AAAGAGGATTTACAGATGCCAAACCATCTCTTGGGCTTCCGACGCTCCTTTCTAGAGTTACGCTTCGACAATGTGCAGAA
TCTGTTGGCAGTGCGCCGTGATATTCTGCCAATTGCGGACAAGAACAAAAAGGGCATGAACGCCATGGACACCTATGCAG
AAATGGCAGCGTACGTCCTTGGATTACTGATCTGCTCTTCTTTGTGGCATCTCTCGGCTTGGGCTAATCCTTCCTGTCAG
GTCGACTAATGCCTTTGACCTGTTTGACGACGCACGCGATGACGAAACGCGGCTGCCGACTTCTGTTGCAGATGCTAGCG
AGTTTGTTGTCGATATCCGAGAATACGATGTCCCGTACCATGTGCGAGTCTTGATTGATATGGGTGAGTCCACAATCCAT
ATTTTCACTCTACTTCACCGTTGCCATGCGACTAACGGCTGCCCAGACATACGAGTGGGAAAATGGTACTTCGTTGAGGC
GAAACATGGCACCCTCTCTGTTACCATCAACGAGAAACGTTTGGCCATGGCAGATCCGGTGGTCATGGCCTACGATATTG
AGACCACCAAGCTCCCACTCAAGTTTCCTGATGCCGCCATCGACCAGGTCATGATGATATCGTACATGATTGACGGGCAG
GGATTTTTGATCACCAACCGCGAAATTGTCTCCGAGGACATTTCCGACTTTGAGTATACGCCACGTCCAGAATACCAAGG
CCCCTTTATGATCTTCAACGAGCCTGATGAGAAAGCTGTTCTCGAACGATTCTTCCTGCATATCAAGGAGGCCCGGCCTA
CAGTCATTGCTACCTACAACGGTGACTTTTTCGATTGGCCCTTTGTCGAAGCTCGTGCTAGTGCCAACGGCATCGACATG
TACCATGAGATCGGCTGGCGCCGCGACACTGACGACCAGTACAAGTGCAACTATTCCGTCCACATGGATTGCTTCCATTG
GGTCAATCGAGACAGCTACCTGCCCCAGGGAAGCCGTGGTCTCAAGGCCGTGACTGTAGCCAAGCTGGGCTACGACCCAG
ATGAGCTGGACCCAGAACTCATGACACCCTACGCTTCAGAACGGCCACAGACACTGGCCGAGTACTCCGTGTCCGATGCC
GTTGCCACATATTATCTCTATATGAAATACGTTCACCCTTTCATCTTCTCGCTCTGCACAATCTTGCCGCTTGGTCCCGA
TGACGTCTTGCGGAAAGGTACTGGTACTCTGTGCGAGATGCTGCTCATGGTTCAAGCATATATCCATGAGATCGTTCTGC
CCAACAAGCATGTATCACCCAAAGAGGCCTTTTGGGAGGGACACCTGCTGGACGCCGAGACATATGTCGGCGGCCACGTT
GAAAGTATTGAGGCTGGCGTGTTTCGAGCGGACATTCCTGTCAATTTCGCCGTTGATCCGAAAGCGTGCGATGAGCTGCT
ACGGGACCTCGATGCTGCTCTCAAGTTCAGCATCACCATAGAGGAGAAAAAATCCATGGACGACGTCACCAACTACGATG
AGGTGAAAGAGCAGATTGCCGCATGTCTGACAACACTCAGAGACACCCCAAACCGCCTCGAACGCCCGCTTATCTACCAT
CTGGATGTTGCCTCCATGTACCCCAATATCATGACAACGAATCGATTACAGCCGGACTCGATGATCAATGAGTCGGATTG
CGCCACATGTGACTTCAATCGACCCGGAAAAACATGCGACAGACGCCTTCCTTGGGCTTGGCGTGGAGAGTATATTCCCG
CCAAACGAGACGAGTACAACATGATCCGACATGCCATTGAAAACGAGAAGTTTCCAGGAAAGTATCGCAACGCGCCAACG
CGCACATTCCAGGAACTGCCGGCAGACGAGCAGGCGGCGCTCATCCGCAAACGCCTACAGCTCTACTCGCAGAAAATCTA
TCACAAGATTCACGACTCAACCACTATCGTCCGCGAGGCTGTTATCTGCCAACGAGAGAACCCGTTTTATATTGACACTG
TTCGCGACTTCCGTGATCGTCGTTACGATTACAAAGGGAAAGCAAAAGTGTGGAAGGGGAAAACGGAGGCTCTCAAGTCG
TCTGGTGCTTCTGCTGCTGAGGTCGACAATGCCAAGAAGATGATCATTTTGTTCGACTCGCTGCAGCTGGCTCATAAGGT
CATTTTGAATTCGTTTTATGGCTACGTCATGCGAAAAGGCTCACGCTGGTATTCTTTGGAGATGGCCGGCGTAACCTGTC
TGACTGGTGCCACAATCATTCAGATGGCCCGGGAGCTGGTTGAACGTCTGGGCCGTCCGCTCGAGCTTGACACTGATGGT
ATTTGGTGCATGCTGCCATCATCATTTCCGGAAAACTTTGCTTTCAAGCTGAAGAACGGCAAGAAATTGACCATCTCGTA
TCCTTGTGTAATGCTTAATCATCTGGTGCACGCCCGATTCACGAACCATCAGTACCAGACCCTGGTCGATCCCAAGGCGT
TCAAGTATGAGACTCACAGCGATAACTCCATCTTCTTTGAGGTCGACGGACCGTATAAGGCCATGGTTCTACCGACGTCA
AAGGAAGAAGACAAGAACCTGAAGAAGCGATATGCCGTTTTCAACGATGATGGCAGTCTGGCTGAACTCAAGGGTTTCGA
GGTCAAACGTCGGGGTGAACTCAAGCTCATCAAGATCTTTCAGCAGCAGATTTTCAAGTTCTTCCTCGACGGTACAACCC
TGGCTGAATGCTATGCTGCTGTGGCAAAGGTGGCCAACAGGTGGCTAGACGTGTTGCATAGCAAAGGAGCAACACTAGCT
GACGAGGAACTCATGGAGCTCATTTCTGAAAACCGCAGTATGGCAAAGACATTGGAAGAGTACGGAACACAGAAATCGAC
GTCGATCACCACAGCTCGCCGCCTGGCCGATTTTTTGGGCGAGCAAATGGTAAAAGACAAGGGGCTTAACTGCAAATTCA
TCATTTGCTCGCGACCGCGAAACGCACCTGTCACGGAACGTGCTATACCCGTGGCCATCTTTTCCGCCGAAGAGCAAACA
AAGCGCCAGTACCTCAAGAAGTGGTTTAAAGAGGAGCCTGCCGATACCGACCCGCGTGCTCTGCTAGATTGGGACTATTA
CCTCGAGCGTCTGGGCTCTGTCATCCAGAAGCTCATCACTATTCCGGCAGCCCTGCAGAAGGTCAGAAATCCCGTTCCGC
GCGTGGCTCACCCAGAGTGGCTGCAGCGGCGAATCAATATCAAGGACGACAAGATGAAGCAGAAGAAGCTCACAGATCTC
TTCGCCAACCCCAAAGCCACTTCCATCTCTGCGGGCGGTCCCTTGGGAGACATCACAAATCTGAACAATGGGATTTTATC
TCGCGTTACAGCAACGGTCACGGTGGCAGCAGATATGGAAGACTTCGGGGCGGCTAGTCAAAATCTACTGAAGCCAAAGA
CGACTGCCGAGGCTATTGCCGGGATGATGGCAGCAGATGCAACGGCTGCGGATAATGCGGTTACCGTCCAAAAACGGAAG
TTCCCTCCAGAAGCTGGCGTCGCAGACGCCTCCCTTGACCCTATGGCCTCTTTGCCCAAGGTTATGCCCTCACCCAGCGA
AGACTACGTCGCATTTCTTCAGTACCAAAAAAAGAAATGGGCCATCCAAAAGCAGGCGCGAATTCGCCGGCGACACCTCT
TTGGAGACCGCAGCAATAGCACCCTCCAAAAGAGCAGCAACATCCAACAGTCTTTTCAGCACCGGGCCGAGATCACCTTC
CGCAACACGTGGCAGCTATTGCAACTGCGGCTGTCTGAGAGCCCTGGTATCGTGTCGGCTTTTGTACTGATCGACTCCCG
CATACACAGCCTGAAGATCAAGGTGCCTCGCCAAGTATTTTTAAACCTCAAGAGCAGAGAGCTTCCGGATATCGAAATCG
ATGGTTGCGAGGTTGAGCAGGTCAACCACACGCTGCCAAATGGACACTCGTCGGTGCACCTGTTCAAACTGACTGTGCCG
GAGGAGGTGTACTTTGCTGAAGCCGAGAAGTTTTCTCTGCTTTTCAATCACCCGAGCATTGAGGGGGTGTACGAGCGGCA
GCTTCCCCTGAACATTCGCGCCCTTCTGCGGCTGGGCAATCTGTGCACGATCGATGAAGCTCAGCAAGGTGTGCTTGGCA
AAGGTCTCGACCAGGGCTTTGACCTGGCAGGCCTGAAGCGGCCCACAAAGCACCTCAAGCCATACCTTGATCCGACCACA
ATGGCATATATTTATGTTTCACACATCAGCTCCGGCGAACGGCAAATTTTCGGGCTTTTCTCCACAACGAACAGTCAGGC
GCATATTGTCATACTGAACAAGCACCGGGACAATGCGCAGGACATGCCCAATGTCGGGAAAATCTACAACGATATGCTAG
GCCGGCGAAGGGGTGTCGAAGCCGAGGCCAAGGCTGCAGCATCAGCGTCTCAGACAGTCCGCATGTCGGCTGCAGACAAG
GAGGCTGCGAAGGCTGCGGAAGCAGCAGCGACCAACTGGCGAGACTGCTTTCCCTACCAAGAGGCGCTGGCTTTCAAGAT
CACGCAGGTCACGACGCGGCGCAAGGTATATCTTGAGATCGGTGACATTGTCAAGAAGATGCACAAGGAGGAGATTGGAC
GGCCGCAGATGCTTGTTGTCCAGTCCTCGCAGCGCAACATGCTCGTGCACGACATTCCCGTGCTCGGCGAGTTTCCGGTG
CTACCGCTGAAGTACGACCCGCTGGACAGCTCGTTGCCGCCACTGGGTTGGCAGTCTGTCGTAGCACGGCGGTTGGTTAA
CCATTACTTGGCGCTGGGATCGTGGGTGCTGCACCTTGTTGGTCTCGCACGCTACGGCGATGTCCCCGTCTGCAATCTGG
AGCGCGACGATCCGCGCTTCATTATTGATGTGGCGTATGCACGTCGCCTGCAGAACAACAACGTCGTGCTCTGGTGGTCC
GGCAGTCCACGGCCAGATCATGCTGGCTATGAGAAGGACGATGTCGTCGGGCCGCTGGAGACTGTAGCCCTGCCGACTGT
CAACAACCCGGGCACTTTCGCGTCTGTCTGCATCGATATTGACGTCCGCAACCTCTCCATCAACACCATTCTGACATCGT
CTCTGATCAATGAGCTAGAGGGTGCGGATGCTGCGGTTTCGTTTAACCCAGCAGCTGATGCAGCAGGGGGCGAGGATGGC
GCAGGTGATGGCGGATCGGGCTCGTTGTACTCGGAAAACGCATTCTCAAACGCTAGTATTCTCGTCTTGCGCGAGATGGT
CAAGGCTTGGTGGGCTGAGGCCTGCAAAGGCAACGCCATGGCCGATCTGGTGGTAAACAACCTGGTGCGCTGGGTCGAGA
ATCCAGACTCGTTTCTGTATGATCGTGCGCTGCACTATTACGTACAGATGATGTCGCGCAAGGCCTTTCAGCAGCTCATG
GCTGATTTTCGGCGTGTCGGGTCTCAGGTGATCTTTGCCAGCGCAAACCGGCTACTGCTGCAGACGACAAAGGCAGAGGT
GGACAACGCATACGCCTACAGCCAGTACGTTCTCAAGAGCATCAAGAGCCGGCCGCTCTTCAGCTTCATCGAGATGGACG
TCAAAGAGTACTGGGACTATCTTGTGTGGTATGACGAGTATAACTATGGCGGCAAGGCGTGCCAGACTATCGAGGACGTG
CCCCCGGGCTCGCTGCAGCCACTCGAGACGATCATGCACTGGCAGATGAACACGTTTCTACCAGTGCGGTTGCAGCCCGT
CTTCTCGGACTGGGTTATCGAGTTCATTCAGCTGATGCACTCCCTCAAGCGGCCGGCTATTGCCGACGACGGCAGCACGC
AGCGTCTAACCCAAATACCCCTCGCGGTGCTGCGAGGCGGAAGTAGTTCCAACAGCCAGACTACGCTCGGTGGCATCAGC
ATGGCCGGCGACGGAAACGGCAGCTCAGAGGTAGGTCCGGTAATTCTCGGGCCAAAATTCGAAAAACCGTTGAAAAGAGC
GATCGCTGGCCTCATCACGGCGCGGAATCGGGAGATGCTTCATCCGGAGCTGGCCAACGACTACGACTTTCCGGTTCTCC
CGGGCTCGCTGGTGTGGTCAAAGGGCACCTCCTCGGTACCTTCGAAAGCGTCACAGTCACGAAACCCGGTCCTCGAGCTA
GTCAAGGCGCTGATGCAGGTGTTGTCGCTGGATAAGAATATTGCTATGGAGGCTCGACTACTGCGCAAGGAGCTGCTTGC
CATGTTTGATGTGCGCGAATTCAGTCGGGAGGGTGCGTTCCAGAATCCATCGGAAAGCCTACGGGTGTCCCAGTTAAGCT
GCGACAACTGCACCATGGCCCGCGATCTCGACTTCTGCCGTGACGAGACCCTGCTTCCGGAACTGGGGCCGGATGGCCGT
CGGGACGCCTCATCCATGAAGCCGTGGATTTGCACGTTCTGTCAGGCCGAGTACGACCGCATTGCATTGGAGGAGCGCCT
TGTGGCTGCTGTAGAAGCCATTGCCATAGAATGGACAGTTCAAGACCTCAAATGTGGGAGGTGTGGCGCCCTGCGTGTCA
ACGACTTTATGGACCACTGCACGTGCTCAGGCGACTGGGGCCCGACAGTGCGGCGGGAGGATATATCTCGTCTGCATATT
TATCGGAACGTGGCTCGCTTCTATGGCCTGCGGATGCTAGGCGATGTTGTCCAGGAGGTTCTTGGTGGGCTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62