GenePrediction:GLEAN_5036 Details

Name: GLEAN_5036
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:159728..157815 (- strand)
Length: 1914
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:159728..159683 (- strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_142:159569..159403 (- strand)
Length: 167
Type: CDS
Source: GLEAN
Position: GCSC_142:159324..159003 (- strand)
Length: 322
Type: CDS
Source: GLEAN
Position: GCSC_142:158953..157815 (- strand)
Length: 1139
>GLEAN_5036 class=GenePrediction position=GCSC_142:159728..157815 (- strand)
ATGTCGTTCGGCGGCCAAACCCCCACGATCATTGTCCTCAAAGAGGGTGCGTGTGCTCTTCTCCCCACATTCCCATCTGG
CAGCCGTTCTCCCCGGATGTCCCCTTGTGCCTCTCCCAACGTTCATGTGGCTAACCGGCTGTGCGCACACGCCTCGTAGG
GACGGACACTTCGCAGGGCAAAGGTCAGATCGTGTCCAACATTAATGCGTGCCTAGCGGTGCAGGCAACGATCAGGTCCA
CGCTTGGTCCCTACGGCGGTGACCTGTTGATGGTTGACGCGAACGGCCGTCAGACGATTACCAACGACGGTGCAACAGTG
ATGAAGGTACGTGGCGGCTCACACAACTTCGGCCCCCAGATCCTGCGTGCATGTAGCGGCCGACTGATAATGAGATTATG
ACAGCTTCTCGATATCGTTCATCCAGCAGCACGGATTCTCGTTGACATTGCACGGTCCCAAGATGCCGAGGTGGGCGACG
GAACGACGTCGGTGGTGGTGCTTGCAGGCGAGATCCTCAAGGAGGTGAAGGAGCACGTGGAGCAGGGCGTCAGCGCGCAG
ATCATCATCAAGGGCCTTCGGAGAGCTTGCACCATAGCTGTCAACAAGATCAAGGAAATTGCGGTCGACACGAACGAGGC
AGACCACCGGGAGACTTTAAGCAAGCTCGCAGCCACGGCCATGACCAGCAAGCTGATCAAGCGGAACACAACGTTTTTCA
CAAAGAGTAAGGCGTTTATATTTCACCGGTTGCAGGCCTTTACTAACCTTCACAGTGGTTGTCGATGCCGTCCTAGCTCT
CGATCAGGACGACCTGGATGAGAAGTTAATAGGTATCAAGAAGATCCCAGGCGGCTCGTTGACGGACTCGTTGTTTGTCG
ACGGCGTGGCGTTCAAGAAGACTTTTAGCTACGCCGGGTTCGAGCAGCAGCCCAAGGCCTTCACAAAGCCCAAGATCGTG
TGTTTAAACGTGGAGCTCGAGCTCAAGGCCGAGAAGGACAATGCGGAAGTGCGCGTGGAGCAGGTGTCGGAGTACCAGGC
AATTGTGGACGCGGAATGGCAGATCATCTACCGCAAGCTGGAGGCGGTATACAAGACCGGGGCCAAGGTGGTACTCAGCA
AGCTCCCGATCGGCGACCTGGCGACTCAGTTCTTTGCGGACCGCGACGTGTTCTGCGCCGGCCGCGTGGCTCCGGACGAC
ATGGAGCGCGTGGTGCAGGCGACGGGAGCGACGGTGCAGTCGACATGCTCGGACATCCGGGCAGAGCACCTAGGCACGTG
CGGCGTGTTTGAGGAGCGCCAGATCGGCGGCGAGCGGTTCAACGTGTTCTCCGAGTGCCCACAGGCGCGTACGTGCACGC
TGGTGCTGCGCGGTGGTGCTGAGCAGTTCATCGCCGAGGTGGAGCGCTCGCTGCACGACGCCATTATGATTGTCAAGCGC
GCGATTCGCAACCGCAGTATCGTCGGCGGTGGTGGTGCCTGCGAGATGGAGGTGTCGGCGTATTTGCACCGCTTCGCCGA
CCGCGACGTGCCGCACAAGCAGCAGGCCGTGATCAAGAGCTTCGCCAAGGCGCTCGAGGTCATCCCGCGCCAGCTGTGCG
ACAACGCCGGCTTCGACGCCACTGACATCCTCAACACGCTGCGCGTCGAGCACCGTCGCGGCCACACCTGGGCCGGCGTC
GACTTTACCAACGAGGGCGTTGCCGACATGCTGGAGCGCTTTGTCTGGGAGCCCGCCCTGGTCAAGATCAACGCCCTGCA
GGCTGCCACCGAGGCCAGCTGCCTGATCCTCAGCGTCGACGAGACCATTCGCAACGAGGAGAGCGCTCAGCCCCAGGCCC
CCTCACGCGGACTCCCGCCAGGTGCCGCCCAGCGTGCTCTGCGGGGCCGTGGCCGTGGCATGCCGATGCGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62