GenePrediction:GLEAN_5037 Details

Name: GLEAN_5037
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:146992..144011 (- strand)
Length: 2982
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:146992..146561 (- strand)
Length: 432
Type: CDS
Source: GLEAN
Position: GCSC_142:146446..145960 (- strand)
Length: 487
Type: CDS
Source: GLEAN
Position: GCSC_142:145896..144011 (- strand)
Length: 1886
>GLEAN_5037 class=GenePrediction position=GCSC_142:146992..144011 (- strand)
ATGCTGTCCAACCCACCATCCACCAACTCCAGCACAGGTGCTCTTCAGGCACGCAAAAGGCTACACCGGAGACAACAGTC
GACGCCGGTAGCCTTTGAAGCCATGAAGATGTCCAACAACCTGCCCAACACTGCTAGTGTTGCCATCGTCATGCAGCAGC
AACAGCAGCAACAGTTTCAGTCCGCACAGATGCAACAAGCACCGATACCTCGGCAACAGCCCGCTCGCCAGTTGGGTCAC
CGCAGAGGACAGAGCCTGGACACAAGGCGTCAGCAGCTGCAACAGAACGTACAACGCCAGCAGCAGATGGAACACCACAT
ACAGCGGCACCAGCTCTTCACGATGACAACGGCGGCAGACGATAGCAGCAGCAACAGCAGCAACAGCAACAGCAACAGCA
ACAACTTCCGGCAGGAATTCAGTAACAGCACAGTAAGTAACAACGCCACTAACCAAGGATTATCAACAACAGCACAACAA
CAACAACAACACGATATGCGAGAAACGCAGCGGCAACGCACAGTACGCCCGGGCCCTACGCGCCAGCCCTATGTCAAGCA
GTCCCGAGAGGAGGCCTTCCTCCTCTCGCCCCAGGGGACACCAGTAATGATCCCGTCAAACTCCCAGCAGTTTGGCGGCC
AGGGGACTGCAAGGAGGCAGCAGCAACAGCAGCAGGACTGCACAGCTGCTCAACTCGAATACGCCAACGGGCACACTGCC
GTGATGATGAGGCGAGCCCTCTCCAGCGACGGCATGCCCATTGGACAGCCCGGCTTTGAGCTCTACAGCAGTCCCGATAC
AGACGGCGGCTTTCCGTCGAACACGTTCATGTCCTTCCAGGACACGGCCAGCTCGGCTCCCATGGGTGTCGCCGCTTCGC
CCCAAGGTTGGGTGTCCGAGGACGACACGTCCAGCACTCGGCGCGGGTCGCGGAGAATCAGCAACACCATCATGGACCGC
GTCGTCAAGTTCGAGTCCCTGGCCGTGGACGGGATGGGCAGACCTACCACGCCCCCGCACCAGCATGAAACCAGTGAGTC
GGCGGTGTAGATTGTCCTGAAGGCCAGGGGTAGAAAATTAGAGGCTGACCGCACAGAATATTTCCCCCCAACACCGACGG
AAACTTCACAGGAGAGCATGTCACAGCAAGTCGATGGCGCCCGGATGGCACGATTCTCGGACGACTATGATGAGTCGATG
GAGGAGACAATCAAGCCGGTCCGCAACCACGGAAACCGGGCCAACCGGTCGTCGGGTGTTTTTGACGACATGCGCCACCA
GGCCGAGGCTATGGCAAATCCCACCCATCCCAACATGATGCAGATGCCCTTGACCCCGGCAGACTTCATGAACATGAGCA
ACGTCAACGCGGAGTTTATGAAGATCCAGACAGGAAACTATGCCGTCATTCCAGTGCCTTCCGACATGCAGCACTTGTCG
CCGCCACTTTCGCAGCAGCCGACTCCGGCATCCATCCAGGGCGTTTTTGATGGCAACACGATCGGCTCGGGCATCGTCAG
CCAGGGTGCTTTTGGCAACAAGACAGACATGTGGCCGACTGACTTCGACTCTAACCTGACTATGCAGTCGTTTGCGACAG
GCCTTTCGGCGGAGGAACAGGCGACAATGTGCCGGCGGCCAGCCCATCGACGCAACGAGTCGATGGCCAGCATCGTCAGC
GCCGCCAGCATTGCGAGCATTAACATTGACGAGACCAGAACCGAGACCGGCGTGACACTGGACGACATTGCCACGTACAT
TGATGGGCCCAACCCGGTCGATGGCAAGTGGCGGTGTCTCTACGACAACTGCAACAAGCGTTTTGGCCGCAAGGAGAACA
TCAAGTCGCACGTCCAGACGCATCTGAACGACCGCCAGTACCAATGTCCACACTGCCAGAAGTGCTTTGTCCGCCAGCAC
GACCTGAAGCGTCATGCCAAAATCCACACCGGCGTCAAGCCGTACCCTTGCGAGTGCGGGAACAACTTTGCGCGTCATGA
CGCGCTGACCCGCCATCGCCAGCGCGGCATGTGCATCGGCGCCTTTGACGGAGCCGTTCGCAAGATTGGCAAGCGTGGCC
GTCCGCGCAAGACACGGCCGAGCGTCGACGAGCGCCGTGACAAGTCTTCTCGCACGCGGTCGAAGCACAAGTCGGCCTCG
GACTCTAGCGGGGGAATGCTGTCATCGTCTCCGGAGATGTCATCACACTCTGGCTATTCAGACAGCTCAGCCGTCAACTC
TCCACGGACCGACGATTCGGACAATGCATTCGACGATGAACCTTTCGAGGGCATGGTTGATGACGCTATGCTGGACATTG
GCTTCGGCCTGACCACCACGACCCCGCATAGAACCAACAGCGGCACGATGAACCCGAACGCTTTGACGGTCTCGTCAGCC
CCGATGCCGGGTGCAGGCATCTCTGCTGAGGAAATGGTGAACCTGATGCCTGTTGTGTCGCCGTCTGAGCATGCTGCCGC
CCTCGCGGCCTCGCCGTCAGCAATGAGCCACTACTCGCACATGTCCCACGCGTCGATGAACAGTGGCGAGCCCAGACCGA
AGGAGCGGGACGGCGAAGACCGCCTGCTTCCCACCAGTCACCCTGCATCCCCCGCCAAGAGCATAGCCAGCCACTACACA
CAGCATCCCAACACACCCCCAGAGCTGTCAGCGTCGAGCTCACCGCCGCATTCTTCCACACACTACTTTGAATTGGACCC
CAACTCGAGCTGTGCGGAGGAAGATTCGATTGGCTTGAGTGCTCCACTGACGGCGGGAGGATGTGGCCCGCTGGGCATGG
ATATGGGCGGCTTCACAGCCGGCCCTCTGGATGATGACGTGATGCTGATGAAGGCCTACACAGCGGACGATGTGCTGGTG
CAGCTCGACAACTCGGGGCTCAGCATGCTGAACACCAGCAAGTTTGACGACGAGTACGGCATGTTCACCAACAACGATGA
CGTCTTCTTCGGGAGCAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62