GenePrediction:GLEAN_503 Details

Name: GLEAN_503
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:196994..197708 (+ strand)
Length: 715
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:196994..197056 (+ strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_97:197294..197630 (+ strand)
Length: 337
Type: CDS
Source: GLEAN
Position: GCSC_97:197701..197708 (+ strand)
Length: 8
>GLEAN_503 class=GenePrediction position=GCSC_97:196994..197708 (+ strand)
ATGAAGTTCCTCAAGGTTGGCCGCGTTGCCATCATCACCCGTGGAAGATTCGCGGGCAAGAAGGTGAGCACTAAGAATGG
CGGGGAGGACTCTCTCTTGTCGAGCACGAGAGCTGCAGGATGAAGAAGGACGAGGCCGACGAGATGCTGGCAAGGGGCAG
ATTGTGCTCCTCTACGGATTGTGCCTCCGCGCCTGCAGGCCTCCGTCCCATCGCCCGCCGGAGGGATTGTGTCAACAGAC
ATGAGAAAGAGCGCCGAGGATGACCGGTGAAGCGGAAATGCTGACAGATGCTCTCCCCAGGTTGTCATCATCCAGCCGGT
TGACTCAGGCAACAAGCTGCACCCGTACGGCCACGCCCTGGTTGCCGGTATCGAGCGGTACCCGTCCAAGATCACCCGGC
GCATGTCCAAGAGCCGGCAGGAGAAGCGGAGCAAGGTCAAGCCGTTCATCAAGATTGTCAACTACAACCACCTGATGCCC
ACGCGCTACACCCTGGAGCTGGAGGGCCTCAAGGGCGTTGTCTCCAACGACACCTTCAAGGAGGTCAGCCAGCGGGAAGA
GGCCAAGAAGACGGTCAAGAAGGTCCTGGAGGAGCGGTACACGAGCGGCAAGAACCGGTGGTTCTTCACTCCCTTGAGTA
TGTTCTTCTCTCTTCCATTGCCTCACTCCGTCTCTCTCTCTCTTGTCGTCATACTAACTGTCTGCAGAGTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62