GenePrediction:GLEAN_5040 Details

Name: GLEAN_5040
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:107141..103981 (- strand)
Length: 3161
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:107141..106996 (- strand)
Length: 146
Type: CDS
Source: GLEAN
Position: GCSC_142:106945..103981 (- strand)
Length: 2965
>GLEAN_5040 class=GenePrediction position=GCSC_142:107141..103981 (- strand)
ATGTTCACGTTCTGTCCCCTGCTGGGGGCGAAGTCAGAGTCGACGGCGTCACAATCGCTGCTGGAGCTCGATGGCGGCGT
CAAGGTGCTGATTGACGTCGGTTGGGACGAGTCGTTTGATGCGGAGAAGCTCCGGGAGCTAGAAAAGTAGGTTTTGCAAG
GGGAGAAGTCGAGGATGTATCGCTAACAACATGCAGACAGGTGCCGACAATCTCGCTCGTGCTGCTGACACACGCGACGG
TATCGCATATTGCGGCCTTTGCACACTGCTGCAAGAACTTCCCGCAATTTGTGCGGATCCCCATCTTTGCGACGAAACCG
GTGATCGACTTGGGCCGCACACTGCTGCAGGATCTCTACGCGTCGACACCGCTGGCGGCGTCGACGATCCCGCGCGGCTC
GCTGGCCGAGGCCTCGTATTCGTACTCGCAGTCACTGTCGGCCGAGCACAGCCAGTTTTTGTTGCAGGCGCCGACGGCCG
ACGAGATCACGCGCTACTTCTCGCTGATCCGCGAGCTCAAGTACTCGCAGCCACACCAGCCACAGGCGCCACCAAGCCTG
CCACCGCTTAACGGGCTGACCATTACGGCCTACAACTCTGGGCGCACGCTCGGCGGAACGATCTGGCACATCCAGCTGGG
GCTCGAGTCGATCGTTTACGGCGTCGACTGGGGCCAGTATAAGGAGAATGTATTCTCGGGCGCAGCCTGGATCGGCGGCG
GCGGCTCGGGTGGCTCCGAGGTCAACGAGCAGCTGCGCAAGCCGACAGCGCTCGTGTCCAGTAGCCGGGCCCCGGCCGTG
CTGCGGCCTGGGCTGCGCGATGAGCAACTGCTGCAGGCCATCCGCGTGTGTGTGGCTCGCGGCGGCACCGTGCTCATCCC
GGTCGACTCGAGCGCCCGCGTGCTCGAACTGGCTTACCTGCTGGAGCACGCCTGGCGCAAGGACGCGGCGGCGGCGGCGG
CCGGAAGCAACGGGAAAGAAGACATTGGCCTCCTGGCCCGGTCTAAGCTCTTCCTGGCGGGGCGCACGTCTGGCAGCCTG
ATGCGACATGCGCGGACACTGCTGGAGTGGATGAACGACGGGATTGTGCAAGAGTTCGAGGCCGTCGCCGACGGCTCCAA
GCAGCAGACAAACAACGGCGGCAATCGAGGCCGAGGAGGCGGAGGTGGTGGTGGTGGCGGCGGTGGCAACGGCGCAGATG
ACAACAAGAACCGAGAGTCGGGCCCGTTCGACATGAAGCATCTACGGCTGCTCGAGCGGCGAGCACAGGTGGAGCGGGTG
CTGAACAGCCAGTCGCCACCGGGCGGCGGAAAGGTGATTCTGGCCAGCGACGCGTCGATGGAATGGGGATTTTCCAAGGA
GGTGCTGCGGCGCATCGCCGACAAGCCACGGAACCTGGTGCTGCTGACCGAGGTGCCGGGCGTGCTCTCCGCCAACAAGC
GCTCGCTGGCGCGGACGTTGTGGGAGTGGTGGAAGAGCGAGCAGGGACAGGAGGCAGCCAGCAGTGGGGGCGGTGGCAAT
CCTGTGCGGGCAGGCGGACGGCATCTCCAGTTCCAAGACGGGCTCAAGGTGGCGCTGGATGGGGCAGAGCTGTTGCTGTA
CCAGCAGTGGCTGGCGACGCAGCGGCAGCTGCAGGCGACACTGCAGACAGGCGGGCCGACGTCGCTGGAGGCATTTGCAG
ACGCGGGCGATGACGTGTCATCATCGTCATCGTCGTCATCATCAGACGACGACGAGCAGTCGGACAGCGAGCGGCAGGGC
AAGGTGCTCAACATCTCGACAACGATTGGACAGGCTAGCCGCAAGAAGGTGGTGCTGCGGGACGAGGACCTGGGAGTGAC
CATTCTGATCAAGCGCAAGGGGCACTACGACTTTGACGTGCGCGGCAAGAAGGGTCGCGAGCGGGTGTTTCCGGTGGCGG
TGCGGCGGAAGCGCAACGATGACTTTGGCGAGCTGATCCGGGCGGACGAGTACCTGCGTGAGGAGGAGCGCGAGGAGGAC
GGCAAGGGAGGTGAGAGCGGGGAGGGTGGTGGCCTAGGGCGCCAGCAGCAGATGAACCAGCAAGACGGACTGGGCAAGAA
GAGGAAGTGGGACGACATTGTCAGCGGCGTCGGAACGCGCGGACGGAGTCGAACGGACGAGCGAACACGAGGCTGGGGAC
CAGGGCTGCGACAGGGCCGAGCAGACGAGCGAGACGACGGCGACGAGGCCAACCGGGACGGCCGAGAGGAGGCAGAGGAG
GAAGAGGAGGACGAAGAGGACGAGGAGCAGCGACTGCAACAAGAACAGCAGCAGCAGTTGGTAGGACCGGCCAAGATGGT
ATTTACGACGGAGACAGTGGTGGCACAAATGGCGATTGGATACGTGGACTTTTCAGGGCTGCACACAGACCGCAACCTGG
AGATGCTGTTGCCGCTGGTGGAACCACGAAAGCTGATCCTGGTGGGAGGCAGTGCGGTCGAGACGGAAGCAGCAGCGACG
CGGTACCGCAATGTGGTCAGCAAGCAACGGGGCGTGGCGGCCGAGGACGTGGACGTGTTCAGCCCAGCCGTGGGTGCGGC
CGTGGACGCAAGCGTGGACACGCACGCCTGGGTGGTGAGACTGGCAGATGCTCTGGTGAAAAAGCTGCGGTGGCAGAATC
TGGGAGGCTTGGGGATTGTTACGTTGACGGGACAGTTGCAGGTGGAGGGTGGTGGTGGTGGTGGTGGTGGTGGAGGTGGC
GAGAACACGGCGAGCACCGAGGACAGTCTGGCGAGCGGCGACGGTGGTCTGGTGAAGCGGCCGAAGATGGAGGCCAAGGG
AGCGGTTGTTGCGACAAGCTCGACTTCTCTGGGCGATGCTCTGCCGACTTTGGACGTGTTGCCAACAGGCGTGGCGGCGG
CGGCACGGGGGGCGGGAACACAGCCGCTGCACGTGGGCGAGCTGCAGCTGACCAATTTGCGGCGAGCAATGCAAAATGCC
GGACACACGGCCGAGTTCCGCGGCGAGGGCACGCTCGTTATCGACGGGTCCGTGGCCGTGCGCAAGACGGCGGCCGGCCG
GGTCGAACTCGAGAGCATCGGTCTGCCATCGGACGGCGGGCCGGCAACACGACAGGGCGGCACGTTCTACGCAGTCAAAC
GCATGATCTACGAGGGGTTGGCGGTGGTGGCAGGCGGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62