GenePrediction:GLEAN_5041 Details

Name: GLEAN_5041
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:102610..99253 (- strand)
Length: 3358
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:102610..100256 (- strand)
Length: 2355
Type: CDS
Source: GLEAN
Position: GCSC_142:100176..99253 (- strand)
Length: 924
>GLEAN_5041 class=GenePrediction position=GCSC_142:102610..99253 (- strand)
ATGCCGTATTTCGTCGGCGACGCAGAGAACGACGTGTCCGTGCTGGCACAGCCTCTTCCGTCGCCCGGTCCCGTCAGCTT
TAGCAAGGGCGTGAGCTCGACGATTTCGAGTCGGCCTGTTGTCGGTCCTCTCGCTTCGGTCGACACCAACGGCTTCGCTC
ATGGCCACCGTGGCCACCGTGGTCCTCCGCCTCCGCCGTCGTACCAGCCGCCATCTCCGCCGCCGACGCTCACCGATGGT
CTCTACGACCGCCACTCTCCCTACTCGTCCGACTCTACTTCCATCTCCGGACTCTCCACCGCCTCCTCTTCGCCAGACAT
GAATGGCCATGGCCGTCCTGGCAGCAGCTCCCGCTCGCATCCGATGCGGCCATCGTCCTCGTCCTCGGCCGTCTCGCTGG
CTCTCTCGCTGACACAGCCTAACCGTCCGCCTCCGCTGCCGCCTGCTTCCTCGTCTTCTGCTCCTCATGTGTCTCACACA
CCTTATGCGAGACAGCCGTCGCCATCGCCGCCGTCACTACCACCACCGCCGCCGCCCAAGACCGACTCACTTTCCCGCAT
TCCTAAGCTGGCCACCAACGGTGTCCCCATCTCCGTTCCCAGCCCGCTGGTCGACCGCACTCGCGTTATGCCCGAAGGCG
CCGCCCCCCGTCTGCCGGGGCTCAGACAGCACCAACACCTCATCGACGACGCCCAGACGCGCAACTCTATGGCCTCTACC
GTCGGCAGTTCTATTCTCTCGCCGACCGGCTTGTCTGCAAGCCTGGTGTCACAACAACAGCAACCGCAATTATTACAGCC
ACAGCAGAACTCGCCCGCTGCACCGCATCGCTTCTCCTCTCCGCCGGCCTACATTCCCGGCACCGGAGGCTCGGCCCCGT
CGTCTTCGGGTGGCCCCCTTCCACCGCCGCTGAAGCATCGCCACACGCTCGAGGTACCCAAGCCGGCCTCGACCGCCCGC
AACTCGCGTGAGGGTGTCGATGCGGCCACGCTCGTGTCCGGCCGGTTCTCGCCCACGGCCACGGCCGGCACAGGCAGCAT
CAGCGGCAGCGTCGGCGGACGGCGGGCATCGCTCAGCCTCGGGCGCAAGAACACGCGATCGATGCACTCGGACATGCCGC
GCGACGAGGTCGTGCCGGACGAAGACGCCCTTAGGTGGACCGAGGCGTACCGGCAGAAGCGGGCAACCAAGAAGCGGCGG
CTCGAGCAGGACGACGACCAGGTCCTCGTCGGCACAAAGGTCGACGAGACCCATGCCAACTGGGTGGCCGCCTACAACAT
GCTGACCGGTATCCGCGTGTCGGTATCGCGCACCAACGCCAAGTTGGATCGACCGATCACGGACGAGGACTTTGAGGCCC
GGCAGAAGTCGACCTTTGACATTGCCGGCAACGAGCTCGTGCCCTCGGCCAAGTACGACTTCAAGTTCAAGGACTACGCC
CCCATTGTCTTCCGCCGCCTGCGCGCCATGTTCCACCTCGACCCGGCCGACTACCTCATGTCACTGGCCGGCAAGTACAT
CCTCTCCGAACTGGGCTCGCCCGGCAAGAGCGGCAGTTTTTTCTACTTTTCGCGCGACTACAAGTACATCATCAAGACCA
TCCACCACTCCGAGCACAAGTTTCTGCGTAAGATCCTCAAGGAGTACTACCAGCACGTTAGCGACAACCCCAACACCCTG
CTGTCGCAGTTTTACGGTCTGCACCGCGTCAAGGTGCCCTACGGCCGCAAGATCCACTTTGTCGTCATGAACAACCTCTT
CCCGCCGCACCGCGACATCCACCAGACCTTTGACCTCAAGGGCTCGACCATCGGCCGCGACTATCCCGAGGAGCGCGTCG
CCGGCAATGCCCGCGCCACCCTCAAGGACCTGAACTGGCTGCGCCGCCAGGAGCACCTCGAGCTGGGCATGATCAAGAAA
CGCCTCTTCCTCGAGCAGCTGCAGAAGGATGTCAAGCTGCTGCAGCGCCTGCATATCATGGATTACTCCCTGCTCGTCGG
CATTCACGACATCCGCCGCGGCAACGATGAGAATCTGCGCGGCAAGACACTACAGGTCTTTGAGCCCGGCACCGACAGCA
ACAACCCGGACGGCAACAACGGCGACCCCCAGTCCGTCCTGCTGCGCACGCCTAGCCGGCTCGAGCATCAGCGCAAGACC
CGTGAGCTGCGCCAGATGCTCAAGGCTGAGCGACCCATTCCCATCGGCCAGAGCGCCAACAAGATGCCCGACGAGCTGGA
CGACAACCGCCAGTCCGTCTTCTACAACGACAGCGGCGGCTTCCAGGCCACCCATGAGGACAACACGCCGTCCGACGAGG
TCTACTATCTAGGCGTCATTGACTGTCTGACACACGTGAGTGTCTTTTTTTTTCACTCTTTTTTCTTTCTTCCTTTCTTG
ATACTTTCCTCCCTCTCCCTACTAACCCCACCAGTATGGCATGGTCAAAAAGATTGAACATTTCTGGAAGGGCCTATCGC
AAGACCGAAATAAGATCTCGGCCCTCCCTCCCCAACACTACGGCGACCGCTTTCTCAAGTTTGTCTCAGGTGTCACGATG
TCGCCCGAGGATGCAGCAAAAGAGCGTGCCCAGGCGGCCGAAGCCGAGGCCCTGGCCGCAGTTGAAGCAGCAGTAGGAGC
GGCCGAGGCGGCTGCCATGGAAGCTGCCGCAGCGAATGGCAGTGGCACTAACGTGCCGGCGATTGCAATCTCTTCCGGCC
GAGACAAGGGCAAGGAAGCAGCACACTCGGGCAGCTGGGCCAGCTCGATGCGGCATAGGAACGCCGGACCGGGACACCGG
AACACGGAAGACGCAGAAGGCTCGGCCTCAACGACGGCAGCACACCGCGCAGCAGAATACGACGCGCTTCAACGAGGGGC
TGTGGCCAGCGAAGGTATGATGACTAAGATCACGGTCACGACGAGCGGTGGCACGCTGCTGCCGGGCGCCGTCGGACCGT
CTGGGTCGCAGCAGCAGCCGGTGCTTCCGATTGTCGAGGAAGCGGGTGAGGCATCGTCGATCGGAGGACAGAGTCGCCAC
AACAGCCGGCCCAGCAGCAAGAGGTCGATGAGGAGTCTGTTTGCTGGCCACCGGCCGACTTCGCCCGCAAAGGGCGAACG
ATCAGGTGGCGAGAATGGCGGCAGCAGCAGCAACAACAACAACAACAACAACAACAACGGCAACAACACTCTCAAGCCCG
ACAGCGCCGACAGCGGCTACGGCGTGTCCGGGACGCGATCCCGGTCCGGCACGGTGGGCTCGAACCACAAGGCAGCGATA
CAGCTGAGCCGTGAGAGCCTGGACAAGGACCTGCCACCACTGCCGCTGTTGCTGTCAGGACCGAATGGAAGGGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62