GenePrediction:GLEAN_504 Details

Name: GLEAN_504
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:203362..205205 (+ strand)
Length: 1844
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:203362..203372 (+ strand)
Length: 11
Type: CDS
Source: GLEAN
Position: GCSC_97:203425..203494 (+ strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_97:203611..203691 (+ strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_97:203768..204544 (+ strand)
Length: 777
Type: CDS
Source: GLEAN
Position: GCSC_97:204606..205205 (+ strand)
Length: 600
>GLEAN_504 class=GenePrediction position=GCSC_97:203362..205205 (+ strand)
ATGGCTGATATGTGTGTCTTTCTGCTTCCGTGCCCACGATGCCTGTCACTTACACCGTTGCAGCAACGTCGACGTTCTCG
TTATCGGTGCCGGGCCAACGGGCCTGGGAGCCGCCAAGCGCCTCAACCAGATTGTGAGATCTATCCGTGGCAAGCTGAAG
CACGGTGGCACTGTGACATTACAGCGCTGCAGCATGGCAACAGAGCTCGTGGCCCACCCCTTGTGCACTGCTAATCAAAA
GCTGCACAGAACGGTCCCTCGTGGCTCATCGTGGACGCCAACGACAAGGCTGGCGGTCTCGCCTCGACCGACGTGACTCC
CGAAGGCTTTGTACGTTATCTCCCGTGATGTGTGTCCGTTGTGCGTCCCGCTTTCTAGACTGACCGCCTTGTGGCACGTT
TTCTAGCTGTACGACGTCGGTGGCCATGTGATCTTCTCTCACTACAAGTACTTTGATGACTGCCTGGACGAGGCTCTTCC
CAAGGAAGATGACTGGTACCACCACCAGCGGATCTCGTACGTGCGGTACAAGGGCCTCTGGGTGCCGTACCCGTTCCAGA
ACAACATCTCGATGCTGCCCAAGGATGACCAGGTCAAGTGCATCGACGGGCTGTTCGACGCGGCGCTCGAGCACCGCGTG
GCCAACACCAAGCCGACCAACTTTGACGAGTGGATTCTGCGCAACACGGGCGAGGGTATTGCCAACATCTTCATGCGGCC
GTACAACTACAAGGTGTGGGCGGTGCCGACGACCAAGATGCAGTGCGCATGGCTGGGCGAGCGTGTGGCCGCGCCTGACG
TCAAGTCTGTGACCCGCAACGTCATCCTCAACAAGGTTGCCGGCAACTGGGGTCCCAACGCAACCTTCCGCTTCCCGGCG
CGGGATGGCACCGGCGGGATCTGGATTGCCGTGGCCAACACGCTGCCGGAGAAGAAGACGCTCTTTGGCAAGAAGGGCGA
GGTGACCAAGGTCGATGCCGACAAGAAGACGGTCACGCTGGCCAACGGCACCACGGTTGGTTACGGCACGCTGGTCAACA
CCATGGCGGTCGACCAGCTGGTCGAGAAGATGGGCGACAGCGAGCTGATCAGCCTGTCCAGGGAGCTGTACTACTCGTCG
ACGCATGTTATTGGTGTCGGCATCCGTGGCGAGCGTCCGGAGCGCATTGGCGACAAGTGCTGGGTGAGTTTTTCTCTCTT
TCTTTTTCTTTTTCTCGTGCCTTGGTCTGTGCTAACCTCGACAGCTGTACTTCCCCGAGGACAACTGCCCGTTCTACCGG
GCGACGATCTTCTCCAACTACTCGCCGTTCAACCAGCCAGAGGCGGACGTGAAGCTGCCGACGCTGCAGCTGGCCGACGG
CAGCAAGCCGGCATCCAGCGAAGCCGAGGCCGGCCCGTACTGGTCGATCATGCTGGAGGTGTCGCAGTCGACGCAGAAGC
CGGTGGACGAGGCCAACCTGCTGCGGGACTGCATTCAGGGTCTGGTCAACACGGAGATGATCAAGCCGGACGACGCGATC
GTGTCGACGTACCACCGCAAGTTCGATCACGGCTACCCGACGCCGGCGCTCGAGCGCGAAGGCGCACTCAAGCAGCTGCT
GCCCAAGCTGCAGGCCAAGGACATCCTCTCGCGCGGCCGCTTCGGCAGCTGGCGGTACGAGGTCGGCAACCAGGACCACT
CGTTCATGCTCGGCGTCGAAGCCGTCGACCACATCGTCAACGGCGCCGTCGAGCTGACGCTTAACTACCCCGACTTTGTC
AACTCGCGCCAGAACACGGAGCGTCGTCTGGCACAGACCTTTGCCTTTGGTACACCGGCGGAGACGGCACTGCCCACCCG
CTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62