GenePrediction:GLEAN_5050 Details

Name: GLEAN_5050
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:2166601..2165606 (- strand)
Length: 996
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:2166601..2166244 (- strand)
Length: 358
Type: CDS
Source: GLEAN
Position: GCSC_97:2166189..2165916 (- strand)
Length: 274
Type: CDS
Source: GLEAN
Position: GCSC_97:2165852..2165606 (- strand)
Length: 247
>GLEAN_5050 class=GenePrediction position=GCSC_97:2166601..2165606 (- strand)
ATGCCTCCGTCTGCCTTGCCCGACTTCGAAGGGACTCCTGTCTTCATTGGGAAGCAGGCTTCCTGGAAAGAAAAGCCCAC
GGACATGGCTGCACCGACAGTCTCTATTACTCGTCCTGTGCAGACCTTCAGTCCACCCCTGTCCCGTTTTATTTCAATGT
GCCACCCCCTTGAGAAAGAGATCAAGGCCGAAGTCGACAACTATTTCCTCACCCACTGGGGGTTCAAGACGGACAAGGAG
AGAAAGAAGTTTGTTGGTGCTGGCTTCTCCCGTGTCACTTGCCTGTACTTCCCGTTGAGCAAGGACGACCGCATCCACCT
TGCCTGCAGGCTCCTGACCATTCTGTTTCTGGTTGACGGTATGTTTGCACAATCGACGTATACGGGATATTTGTGAACTC
ATCCCGTTGCAGATATTCTAGAGGACATGTCTCTCGAGGACGGCCGTGCCTACAATGACAAACTTATTCCCATTGCTCGC
GGGGACGTCCAGCCGGATCGGTCTGTCCCCGTCGAGTGGATTATGTACGACCTGTGGGAGATGATGCGAGCCCAGGATAA
AGAACTGGCGGATGAGGTCCTGGAGCCGACCTTTACCTTTATGCGCGCCCAGACGGACAAGGCGCGATTGTCCATCCGCG
GCATGGGCCCATACCTCGTGTACCGTGAGAAGGACGTCGGCAAGGCGTAAGAACTCTTCTTTGGGGAATAGAACAATGCG
GAATGAATATGCTGACAGTTTGTGAATAGCCTTCTCTGCTCTCTGATGAGGTACTCTATGGGCCTCTATGTCACCCCCGA
AGAGCTGGCGTCAGTCCAATCCATCGAGCAGAATGCCGCCAAGCACCTGTCTGTTCTCAATGATATTATGAGCTGGGACA
AAGAGTATGCGGCTGCTCAAACAGGCCATCCTGAGGGGTCGGCGCTCTGTTCAGCTGTTCAGGTCTTGGCGGATGAGACG
TCTATCACGTATGACGCTGCCAAGAGGGTCCTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62