GenePrediction:GLEAN_5051 Details

Name: GLEAN_5051
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:2162491..2158741 (- strand)
Length: 3751
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:2162491..2162219 (- strand)
Length: 273
Type: CDS
Source: GLEAN
Position: GCSC_97:2162160..2161893 (- strand)
Length: 268
Type: CDS
Source: GLEAN
Position: GCSC_97:2160994..2160559 (- strand)
Length: 436
Type: CDS
Source: GLEAN
Position: GCSC_97:2160497..2160117 (- strand)
Length: 381
Type: CDS
Source: GLEAN
Position: GCSC_97:2160052..2158741 (- strand)
Length: 1312
>GLEAN_5051 class=GenePrediction position=GCSC_97:2162491..2158741 (- strand)
ATGGCTGTCGACGCATCCGACCAGAGCGAGTCGCACGATTCTACCAGGTTTAACAACGTTGATGCTGCGTCCGAGGAGAA
ATCAATTGAGGAAGGGGTGATGGCACTGACGCCAAACCACGAGGATGTATTGAAAGATCAAATCACCGGTCCTGTGACCT
GGCAGGGCTCCGTCCGCTTTCTATTGAGTTGCACTAGCACTATCGATGGACTTGTGCTGGGATCGAGCGCCGTTGCGGCC
ATAATAGGAGGTGCAGCAACCCCCTTTGCAATGGTAAAGTGATAGGGGTACTGATTAATATTTGGATGACATAGACTAAC
GGGTAAGGCAGCTTCTATTGGGAAACATGGGACAGTCCTTTCGCGGCTTTTTCATGGGGCACACGACGCTTGACAAGTTT
AGCGATGAAGTCGCTAACATCAGTCTTCTCTACGTCTACCTGGCAATCGTGGAGTTTTCTGCCATATACTTTGCGACGGT
TGGTTTCACCATGGCGGGAGACCGAATTGCTCAACGCGTCCGGGAGAAATATTTGGCTGCTGTCCTGCGTCAAAATATTG
CTTACTTTGACGGTCTTGCCATCGGCGAAGTCAACACGCGTTTGACAACGGACATCAATACCATCTAGGATGCCATCACA
GGAAAAGCGTCGGCTACACTCTCGGCTATAGCAACATTCGTGTCGGCCTTGGTTATCAGCTTCATCAAAAGCTGGGTATT
GACTCTGGTGCTGTTTCCAGCTCAGGTGTTGATGGTCATATCCATGAGTGTTGGGGCATCCTTCATGGTTAAGTACACGG
CGCGATCGCTCCGGGCGTATGCTTTGGGAGCCAGCATAGTAGAGGAAACTATTCGATCTGTCCGTACGGTCACGGCGTTT
GGGATGCAACAGCCCTTGGTGGGCCGCTACGAAGAGCACGTGGCCAAGGCCCGCGAGGCTGGCACCAAAAGTGGTCTTGC
GTTGGCTTGCATGATTGCAGCATTGAACGGCATTATATTCTGGAGCTACGGATTGGTCTTTTGGCAGGGCTCTCACTTTC
TCATACAGGGAAGGGTGTCGCTTTCTGCCATCCTCACCATTCTGTTCGCCAATCTCGCCGGAGCATTTGCATTGGGTAAC
ATAAGCCCTCATACTCAAGCATTCGTGAATGGAATCGCGGCAACCGACAAGATTTCGCAGACATGCTGTCGTCACTCGCC
TATCGACCCGAGTTTGTCCACAGGAAGCAATAAAGAGCCAGTAGTAGGGGCCATTGAGCTACGAAATGTTAGCCATGTAT
ACCCATTACGCCCGGAAGCTCCGGTATTGAAAGATTTCAGCCATTACTTCCCCCTAGGAAAGATGACTGCCATTGTGGGC
CCTTCTGGCTGCGGTAAAAGTACCATTGTGAGTCTCTTACAGAGGTTCTATAACCCAGTGAGTGGCAAGATATGTATGTA
TCCATTCCCTAAAGGAGCACAGCATTTTTGGGAGCACTTTGACTAATCGGCGACAAGTTCTGGATGGTGTCGATATTTCT
ACACAGGACGTCTCATGGCTAAGACAGAAAATTGGCCTTGTTGAGCAAGATCCGACTCTCTTTTCAACTTCCGTTTATGA
AAACATTCGCTTTGGCCTTGTCGGATCGGCTCATGAGAACCTCGATGACGCTGCAACACAGAAGTTGGTGGAAGATGCAG
CAAGACTTGCCGACGCCTACGACTTTATCATGGCTTTGCCCGAGGGGTTTTCAACAAACGTGGGAGACTCTGGATCTCTC
ATATCTGGTGGCCAGAAGCAAAGGATTGCTATTGCAAGAGCCGTCATAGGCGATCCGAGGATATTGCTTTTAGACGAGGC
AACCTCCGCGCTAGATGCAAATGCGGAGCGTCGCGTTCAAAGAGCTCTAGAGAATGCATCTAAAGGACGAACGACGATTT
CGATTGCCCACAGGTAAGAACACAATCATCAAAATACTGCAATATTAGAAGAGGTCGAATCTAATGTCGAACAGACTGTC
GACCATCACTCGAGCAGATAACATTCTTGTCATGTCCGAGGGCCGCATCGTTGAACAAGGCTTACACACAACCCTCATGG
AGTACGACGGCATCTATTCCAAACTGATCCAACATCAGAGTGTTCAAGACCCAGGAAGGAACAGAACCGAAGTTGATGTC
CCACTACAAGAAGGAGTGGACAAGGATGTGTCTCCCAGGCACTCCGAATTGATCAAACAGTCTACTGGGTCTACCGCCAC
AATACTTGAAGAAAAGACTACTGCGAGTTCTATCTGGAGCTTGGCTCTCTTTGTTTTCGGTCTCAACCCTAAGGGCCGGA
CGTTGATTCTTCTGGGCGCCTTGTTTTCCATCGTTGCCGGGGCGAGTCATCCAGCGTATGTTGGGACCAGCACCACGCCC
GAATCCTTACCCAAGATGAGATGCTGACACTGGGTGTAGACAATCCGTTTTCCTCGCCAAGATCATCGCCGCCCTGTCTC
AAAATCCATCCGAGCATAAAAATGTGCGTGAAGAGGTTGATTTTTGGAGTTGGATGTACTTTATGATTGGCTTCACCACC
GTTGGCGGGTGGCTAGGGCAAGGCGTTTGTCTAGCGTATTACTCGCAACGACTTACACACATTGCTCGTGTCAAGGGGCT
TGATACAGTACTGCACCACGACATTGGCACATTTTCCCGCAACGACCACTCTACTGCCGCTCTCACCAGCATTCTCTCGA
CAAGCGCCTCCAGTCTCCAGGGCCTATCAGGTGCAGTTCTCGGGACACTCCTTGTAGTTCTGACGGTTCTGGTTGCAGGA
TTCGCCCTCTCGACAGCCATCGGATGGAAGCTTGCTCTTGTCTGCGCGACGACAACCCCAATCCAGATTGCATGTGGTAT
CATTCGCTTGAAATGTGTCGCCATGCTCGAGGGCCACTCTCGCCAGGTCTACGAATCGTCTGCCATCTATGCATGCGAGT
ATGGTTCCAACATCCGCACTGTTGCAGCACTTACGTTGGAAAGAACCATACAAAAGACCTACCATCGACTTCTTGAAATG
CAGCGGAAGAAATCTCTGCTATTGGTCAGCCAATCTTCGCTACTTTATGCAGCATCGCAGTCGTTGAACTTCTTGTGTGT
CTCGTTGACATTTTGGTATGGTAGTCGGCTAGTGACAACGGAAGGGTACACCATGTTCCAGTTCTTCGTCTGCTACACAG
CCATCATAGCTGGATCCTTCTCAGCGGGAGCCATCTTCTCGTTTGCACCGGATATCGGGAAGGCGAGGGACTCGGCTGAG
CGTATGCAGGCTCTGTTCTGTGAACCGGTCAACATTGATGTACGAGAAGACGGAGGGTCCTCGTTTGACAATACAGATGG
GACAATCGAGCTTAAAAATGTGTCTTTCCGGTACCCCAGTCGTCCCGAACACATGGTACTCGACGATATTAATATTACAA
TCCTATCTGGTAAGTATATCGCCTTAGTCGGATCCAGCGGCAGCGGCAAAAGCACAATTATATCGCTTCTTGAGCGTTTC
TTCGACCCGGACGATGGCCAGGTGTTTTTCGGATCTCAGAACATCAAGGATCGGAACTTGAGAAACTATCGCCGACAGCT
AGCTCTTGTGAGTCAATCGGCGACTCTTTTTGACGGCACGATACGCGACAACATTATCTTTGGCGTGGAGGACGAGAACT
TCAGCGAAGAGGCCGTTATGCAAGCCTGCAAAGATGCCAATATTTTGGATTTCATATCTTCTCTGCCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62