GenePrediction:GLEAN_5053 Details

Name: GLEAN_5053
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:2153037..2151385 (- strand)
Length: 1653
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:2153037..2151626 (- strand)
Length: 1412
Type: CDS
Source: GLEAN
Position: GCSC_97:2151571..2151385 (- strand)
Length: 187
>GLEAN_5053 class=GenePrediction position=GCSC_97:2153037..2151385 (- strand)
ATGGAAGGTCCTCTACATTTGCTGGCTAAATGGCCAATGACGATAGCAACTGCTGCTTTTGGATTCTACATTGTTGTTCT
TGCAATCTACCGACTATACTTCTACCCTCTAGCTAAGTTTCCAGGACCAAAGATTGCCGCACTGACGCTGTGGTACGAGT
TTTATTACGATGGCCTTAAACGAGGGCGGTACACCTTTAAAATTGGGAAAATGCACGAGAAGTACGGCCCGATTGTTAGG
ATCAGCCCTAATAAGCTCCATGTCAACGAGCCCTCCTTCATCAATGACCTCTATGCCGGTGGAGGCAAGAGGCGAGACAA
ATACGCCTACTTCAGTGCTCAATTCGGTATCCCAGACAGTGTCTTCGGTACACCCGGGCACGATCTTCATCGTCTCAGGC
GTGGCTCTCTCAATCGCTTCTTCTCCAAGGCGTCTGTCACCAAACTCGAGCCCATTATCCACAACGCCATTGAGAAGCTT
ATTTCTCAGCTCCAGGCGCACACGGGCTCGGGAAACCCTGTGGCCATGACCATGGCTTTTAGCTGCATAACGACAGATGT
TGTTACCGAGTACGCCTTTGACAAGAGCTATGATTTCCTGGGGGCGCCAACATTTGAGCCAAATTTCCACCGAGCCATCA
TCGCTGGTACCGACATGGGCCCATGGTTTAAGCAATTCCCGTGGCTCATTACATTGATGAACCAGATTCCCCAGTCAATT
GTCACTTGGATTAATCCAGAAGCGGCTGTCTATGTCCAATTCCAAGAGGATATCCGGCGCCAGATTCGACAGGTCCAACT
TAGCGTGGCTGAAGACAAAGTTGATCGTGGAACTGGTAGGACAATATTTCATAAGCTTCTTACGGGTGATTTACCTGAGC
GAGAGAAACGACTGGAGCGGCTTTGGCAGGAGGGCCAAATTGTCATTGGTGCTAGGACTGAAACAACCGCCTGGTCTCTT
TCAGCAATTCTGTTCTATGTCCTAAACGACCCAAGGATTCTAAGAAATCTACAGAATGAACTTTTTGCGGCCATCCCAGA
CCCCAAAGAGAGAGTCCCCTACAGCAACTTAGAACAACTGCCATACCTTAGTGCTGTTATCTGCGAGGGACTCCGGCTCT
CCTATAGAGTCAGCACACGTCTCCAGAGAATCAACCCCGATGGTCCCTTTTTCGTCAAGACTAATGCAGACTCGAGCAAA
ACGGGGAACGGTGGCGTGCGTGTGGTTGAGATACCACCCGGAACACCTGTTGGAATGACGGCTGCACTTATTCACAACCA
TCCGGATCTCTTTCCGAACCCCGACGACTTCTGTCCAGAACGATGGCTTGATAGCAATGGTCAACGTCATCATAATCTTA
ACAAATATCTCTTGTCTTTCTCACGTAGTAGTCGGCAGTGCATTAGTATCAAGTAAGTCAATCAATAAGGCCTGATCAGA
CACAATCTTACTAACATGCAAATTAGTCTTGCGTATGCTAAGCTCTATTTAGCATTTGGCTTGCTTATTCGTCGCATAGG
CTCAAGCCTCCGTCTTTTCAACACAACCAAGGACGATGTTAAGATTCACTACGATCGATTTGTTCCGACACCAAAGGATG
GGACAAAGGGAATCCGCATTACTATCCTCCCTGGTTCGGAGTCCTTCATATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62