GenePrediction:GLEAN_5054 Details

Name: GLEAN_5054
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:2149239..2147762 (- strand)
Length: 1478
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:2149239..2148764 (- strand)
Length: 476
Type: CDS
Source: GLEAN
Position: GCSC_97:2148702..2147987 (- strand)
Length: 716
Type: CDS
Source: GLEAN
Position: GCSC_97:2147916..2147762 (- strand)
Length: 155
>GLEAN_5054 class=GenePrediction position=GCSC_97:2149239..2147762 (- strand)
ATGCCACTTCATACAATCCTTAAACCCGTCCAAATCGCAGCAAACCTCGTGAATGCAGCATTATCTAACGAGTCCCCGCA
TAAGTACCGTGATCGTTTATTCAAAATTCCTACATCTAATAAGCCAATGGTTATCGTACCAGGTCACCTTCTTGATGACT
TGAAAAGCTTTCCCGAGGAGGCCATCAGCTTCCGCCACGAGATGTACGATCGCTACCTTGGTCAATACACCTCGGTGGCA
TCTAATAGTTCTGCCATGATTCACTCAGTCAAATTTGATCTGACTAAAGGCATCGGTAATCTTATTCCCGTTATACAAGA
GGAGGTTGAGTACGCTTTAAAAGACTTCATGTCTACGCACGCATCGGACCCGGAAGGATGGGTTAGAGCACCTATTTACG
GCATGTCTACACGCACTATAGCCCTGGTCTCTGGCCGGGTCTTTGTAGGCTTGCCACTATCGCGGAATGAGGAGTGGTAA
GTTCCCTTCACACCCAACTACCTCTCTCATCATAGGATTCGTCCTAATAGAATACAGGATTCAGATGGCCATCAACTCAA
CGATAGACTCATTTGTTGGCGCAGCCATGATGTGGGAGTATCCCTCGTGGTCTTGGCCTATTATGCAGTGGATTGTACCT
CAAACCAAGAGAGTTCGCTACTATCGACGCAGAGTGGGCGAGATGCTGAACCCGATCATCACAACCCGACTGCAGGCGGG
CTCGGATACCAAGAAACCAGCTGACATGATTCAATGGCTCATTGACAACTCGAATGGCCGTGGCGGGGACTTGCCATTCC
AAGCCAATGAGCATATTGTCATGAATGTCGCAGCAATCCACACGACGGGAGGACAACTGGCCCACACCATCTTCGACCTA
GCACGACGCCCAGAATATATTTATATTCTACGTGAAGAGATGGACAATGTCCTTTCAGATGAAGGGCCCATAACTAAACA
GGATCTTTTCCGGCTCAAGAAGATGGACAGCTTCCTTCGCGAAGTGCAGCGGATGAGCCCCCCATCCATGGTTTCGGTCA
ATCGCAAGGCACTCAAGTCCCTTACGCTGCCCAATGGTCTGGTGATTCCGAAGGGTACATCACTCGCCGCCTCGCCTGCA
TGTGTGAGCAGGGATTCCTTGATCTGGGATAACCCAGATGAATTTGATGGACTCAGGTTCTACAAATTGAGAGAGGCCGA
AGGAGAGGAGAAGTATCAATTTGCTACTGTCAACGAAGATGCGTTGAGCTTTGGTGAGTAACCAATACTGTCCCCATATT
TATTGGCCTGAATCTAACCATGTATTTACTTGTTCTTGGTTAGGTCATGGCCGGCACGCCTGTCCTGGACGCTTCTTCGC
CTCTGCGGAACTCAAGGTTGTCTTAGTTCACATTCTTCGAGAGTACGATATTAAGTTGTGTGATGACTACAGCAACGATC
GGGATCTTAATCGCTTTGTCGAGGTTATGGCTGCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62