GenePrediction:GLEAN_5055 Details

Name: GLEAN_5055
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:2127551..2126118 (- strand)
Length: 1434
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:2127551..2127405 (- strand)
Length: 147
Type: CDS
Source: GLEAN
Position: GCSC_97:2127350..2126118 (- strand)
Length: 1233
>GLEAN_5055 class=GenePrediction position=GCSC_97:2127551..2126118 (- strand)
ATGTATGGGCTGGGTGCTGGTGCGACTGCCGACCTAGGTACTCTAGAGCTCGCCACACGTTCAGTTGCCCAGCATGCGAA
GGCTGGTGCCATTGTGGTCGAGAAAAGCACTGTGCCATGCGGTACAGCTAGGATGATATCCGATATTGTGAGTTATGTTT
CATTAACTAATGCTGTGCGTGTAACTGATTGCAAATTTTAGCTTGGCCAGGTGCGCCCAGAAATGAGTTTTGAGGTGCTA
TCCAACCCTGAGTTTCTTGCTGAGGGTAGTGCAGTCAATAATCTGATGAATCCAGACCGTGTCTTGATTGGCAGTGACAA
ATCTGCTAAGGGATTGCGCGCCGCAGAAGCATTGAAGGCTGTCTATGGAGCTTGGGTTCCCCACAAACGAATTTTAACTG
TTAATACTTTCAGCAGCGAGCTGACAAAGTTGATTGCAAATGCCATGCTCGCTCAACGCATCAGCAGCATTAACGCCGTC
AGCGCTCTCTGCGAAGAGCTCGGCGCGGATGTCGAGGAGGTCAGTCGTGCTCTTGGAGCCGACTCGCGTCTTGGCCCGAA
GTTTTTACAGTCCGGAGTTGGCTTTGGGGGCTCTTGCTTCGAGAAGGACATTCTAAATTTGTCTTGGCTGGCATCATCTC
TGAATCTGCCGGAAGTCGCGCGTTATTGGACGGAGATCTTGACCATCAATCATTACCAGCGGGAGAGGTTCACCCGGACG
GTATCTCGCAAGCTCAATAACACTTTGCGCGGGAAAAAAATTGCCATATTCGGCTTTGCATTCAAAGAGGGTACGAACGA
TACCCGGAACAGCGTCGCTGTTCATCTGATTGCTGAAATGGCTGCGGAGCTTCCACAGGAGATTGCAGTATATGACCCTG
GTTGTGCCGTCGAGGAAGTTGAAGAGGAGATACAGCGCGTGCTAGGTCACAAATATTTGCACATGGCTCGAGTGAAGGTC
CGATCGAGCTGGCTTGAGACCGTTGAAGGTGCCTCGGCTGTTTGTATCTTGACTCCATGGGCTCAGTTTCGTGGCCAGCT
GCTCAACACCGTTGGCTCGTCTAGCAAAGACAAACCTGCGCACCCTACCAGAGACAATCTCCACGAAGGCCCTGGAATTT
CTATCTCAGCTACAGGTGAAGGCGCTTTAAGTGAGATGGATATAATCACGCTAGAGGCTATGAATGAGAGCCTAGACGAA
GTGGCTTCGGATGATCCTTTGAGGCGCTTTCTTCCACAGCCTGTGTGCCTTCAAGGCTGCAAGGCCTGCGCTACTACTTC
TCTTGAAAACAGGGTCGAAGAACTGGTCGATTGGAACTTGGTATTCAAAGTCATGAAACAGCCCAGCTGGGTGTTTGATG
GCCGCAATATTGTAAATTCGGCTCTACTTCAGGGAATGGGTTTCAAGGTCCACAGCATTGGTAAATGTTTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62