GenePrediction:GLEAN_5057 Details

Name: GLEAN_5057
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:2112083..2105534 (- strand)
Length: 6550
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:2112083..2111982 (- strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_97:2111937..2109241 (- strand)
Length: 2697
Type: CDS
Source: GLEAN
Position: GCSC_97:2108554..2105534 (- strand)
Length: 3021
>GLEAN_5057 class=GenePrediction position=GCSC_97:2112083..2105534 (- strand)
ATGGCTGAACAGGAAGAGGACTTTAGTTCTCTGCCGTTGCCAGACCGCTTCGGCCACAAGGCACGTTCCAGCAAATCATA
TCTGCAACTGGTCGCGACGGAGGTGACTAGCACCGGTCAAGCTGTGATACTAACTTTGATCTATAGGCATGGAAAGTGCG
CAAGCAGGTTTACGAAGACGCCACCAAGCAATTCGAGCGTACCCCTGATGAGCGCGATCCCGCGTTTCGACCGTTTCTAC
AAGACCCAGGACTATGGAAAGGTGCAGTGGCAGATTCTAACGTTGCGGCGCAACAAGAAGGTGTGGCCGCACTTTGTGCG
TTCCTGAAGTTTGGTGGTCGCGAGGCATGCCTACGCACGAGAGGGGTCACAATAGGTCCGATTGTTGAGAAGTGTCTACC
GTCGACGCGCGCAGCCATCAAGACGTCCGCGATTGAGGCGCTACTCTTGTACATCGAGCTCGACGTCGCCGACCCCGTTG
TGGAAGACATGCTTCCGTCCTTGTCAGCAAAACAACCAAAGGTGATTGCCGCAACCCTTACCGCTCTTACCACCATATAC
CACAGTTACGGCTGCAAAGTCGTCGATCCGAAACCCTCTTTGAAAGCTTTGCCGAAAGTGTTTGGTCATGCAGATAAGAA
TGTCCGTGCGGAGGCTACAAAACTGGCGGTCGAGTTCTACCGGTGGCTACGCGAAGCCATGAAGCCGATGTTCTGGGGCG
ATTTGAAGCCGACGCAACAAGCAGAGCTTGAGGCCCAGTTCGAGGAGATCAAAAAAGCCAACGAGGCGCCAAAACAAGAC
CGGCTTTTGCGGTCACAGCAAGTGGCGCAGGCCAAAGCCGTTGCGTCGGGAGTTCCAGAGGACGCCGGCGATGCTGGCAT
AGATGACGAGCCGGCCGAGGTCGATGCATTCGATCTAGCAGAGCCACAAGACGTTCTACGCAACGTACCAGGCGACTTCC
ATGAAAAGCTGGCATCGTCTAAATGGAAAGAGCGCAAGGAGGCGGCGGAAGCGCTGTACGCGGTCCTCAACGTGCCCCGC
ATCAAGGACGGTGACTTTCACGAAATCAACCGCGGTCTGGCCAAGTGCATGAAGGACGCCAACATTGCCGTAGTGACACA
AGCGGCGCAGTGTATTGAGGTCTTAGCTAAAGGCCTCCGGAAACCATACGGGAAATATCGCACGATTGTCATGCAGCCGA
TCCTGGAGCGACTGAAAGAAAAGAAGCAATCGGTAGCCGACGCGCTTGGGGCTGCACTAGACCAGGTATTTCTGGCAACA
GATCTAACGGAATGCCTGGAAGACATCACAACGTTTTTGTCACACAAGAACCCGCAGGTCAAAGAAGGCACAATGCGGTT
TCTAATTCGGTGTTTATGCGCAACGCGCAACGTCCCAAGTAAGCAGGAAATCACGACAATTGTGGACTCGGCAAAAAAGC
TTCTTTCTGAGTCCAGCGAGGGACTGCGATCAGGGGGTGCCCAGATGCTAGGAACAATCATGAAAATTATCGGCGAACGT
GCCATGAACCCACATATCGAGGGTCTTGATGAAATTCGCAAGACAAAAGTGAAGGAGTACTTCGACACTGCTGAGGTCAA
GGCGAAGGAGAAGCCAAAGGCGCCGCCGCCAGCCCCGGCAGCAGGACGTGCGCCTGGCGGCGGACCGCCGAAGAAGGTGG
TAGGTGGCGGTGGAAAGAAAGGGCCATCGCCCCTAAAGAAGCCAGTGTCGAACAGTGCCTCGGTTGCGATTCCAAAGGAA
GAGCCACTGGCACTACAAGCCACGTCCCGGCCTGCTGGTGGCGGCAGCAAGCTGGGTGTACCGAAAGCTTCTGTAAAGGC
CCCCCAGAAGCGGGCCTTAGCCGGCCCAGGAGTGCTATCACCTCGACACGCCGCCCCTCCGCCTGTGCAGGACGACTATG
ACGACGACCCGGTGGCCACAACACCGGCACTGCAGCCTCGGATAGGGCTTGGTCGAGGAGGCTTAGCGTCGCGATCATTG
GCTAAGCCGTCCACCAATACTGCCGCCACGGTACCGGCACCACCCTTGTCGCCCACGCCCATGTCTGGGTTGACAGCGCT
GGAGCGGGAAGAGCTGGAGGAGCTGCGGACATCCAACGACCGACTATTGCGGCAGGTGGACGATGCCCGCCATGAACGGT
CAAAGCTGATGTCGGAGGTCCAGGAGCTCAAAAACCAGAACGCAGGGCTTATCGAAGATCACACACGTGACGTTTTAAGC
ATCAAAGCGAAGGAAACGCAGCTGGTTCGTGCACGCAGCGATGCCGAGGCGGCCGAGCAGACCAATGAGCGACTTCGTCG
GGAATTAGACCGGCTGAAGCGTGCCCTCGGCAAAGCGGAGGCGGCCATGCTGAATGGGTCTGGCGGCAGTTCAAGCGGTA
TGGTTAGCCCCGATTTGACTCATGACGATGCCGGCATTTTTCGTGATGGGATGTATCCAAACAATGCCGGCCGCCAGCGA
ATGAGCTTTGCGAGCACGCTTTCCGAAGAGAAAGAGAACGGCGAGACAGCGTCCTATGCACGGAGCAAGATGAGCCCAGA
TCTACGCTATGCGGCGACCGGCAGTGGGACAGAGAGTGGACGTGGAAGCCCTGCACGTAGTTACCGAAGGGAATTTGGTA
TTGACGATGTCAGTAGCGCTTCGGGTGGTGGATACGGGACAGGGACCGGATACGGAGCCAGTTCTAGCGGCAATGGCACA
TCCAGCACAACCTACAACGGTAACATCGGTGGCTCCGGTGGCGCTGGTGTGGGTGGGCAGGAGAGCTGGAAGCGGGCGGC
AGAGGTTACTAATCAGCTGAAGGCACGGATTGAGCAGATGAAGGTAAGCGTTTATGCAGGCTGGACGACTATGCTGATGC
TAACATTCCGATGTGTAAGGCCAAACAGGGGATCAGGCGAGGGCAATGAGTCGTGGACGGCATCCTGGGATGGAGAAATC
GTGAATAGAATTCGGCTGGACATGGACAGGAACCTGGAGGGCGGAGATTGGGATTATGACTGGAAAATTTACAGAGCGGG
AGAGCGATGTAATGATTGTGTCTTCACATTCTCAGTCATTGCATGAATGTTGCCCGCAATGCCACAACAAATTCGTTGTC
TGTATGAGTAACGAGCGAGAAGTGTGTTCTACTACATGCCGTTGGACTTTATACTCTTTACATGCCAATGCCAGCGACGC
CGTTGTATGGTCTATGACCGAATCCTGCTAATGTATGGATGCGTACTCCGCATAGCATGAGGGTAACGTAAGATACATGC
AGTCCTTACTGCTATACGTAGTACGGAGTAGCCTGCGGAGTAAAGCGGTGAAAGCCATTCTCGTGCTGTTGTTACAGGTA
TATAATTGTGGCAATATGATGACTAAGCCATAAAACTAAGCTAGCTCTACTGACAAAAATGACAATGCGAACGTCAACGT
GCGACTTGGTCTCAACAGAGCTCATTTAGTACGCCTTATAATTGGCACACTTTGTTTTTCCCGTTGTAAACAAGATTGAT
TCTACGCAGGCCCGCTCCTTTGAAGCGACCAAGATGTCGAAGGCCGCGGCAGCCGATTACTCCAACTCTGATTCTGACTC
CGACGGAGAAGACGACGCGTACCCAAGGCCCGCAACTGGCCCAGCAACCGACGAATTTGCCAGTTACCACCCGCGCAAAC
GGCGGCGCATAGGTCGTGACGCAAAAGAGAGCGCAGCTCTAGGGATTTTCGGGTCAGAAAGCGAAGACGAGTTCAGGCCC
GATCGGCGATGGAAGCGGAAACCGCTGCGCAAAGAAGGCGTCAGCTTTGTTTCATCTGGCACACAAGAGCAGGGCAGTGA
TGGGGCCGAAGATGACAAAATCGAAGATGAGGATGTTGCAGAATGTGGACTTTACCAAGAATACCAAGAAAAGGAAACCA
CGAGAGAAGAAGTACAGGAGACAGGTAGCGACGATGACGAAGCTCGCTACGACAATCACTTTGGAGGAGTGAGCTTTGGA
TCACACGAAGTCCACAACTTGGGCTTTACATCCGCATCATCGAACCATGCTCCAGTTATGCCACCACGTGCGGTCCCTAT
ACCGGAAGAGTTGGCATCGGTTACCGGCGTCAATGTGAGAAATCCACTTGGGCACGGGTTTGTACCATCCTCGGCGTTGG
ATCCCGTCCTGATGGAATCTGTCGCACAAAGCCAGAACGTCGGCAAGCCGAATATAAGTGCGAAACCTAGCGCATTTTCG
GCAAGGGGCTTAGGAAGAAGCCGAGGTGGTGGTGGTGGGCAGGCCAGGTTCAACCCAAAATCTTTCGGCGCTCGCATGAT
GGCCAAGATGGGCTACGTTGAGGGGTCCGGCTTAGGTAAGGATGAGCAGGGCCGAAACATAATTATTGAGGCCAACCTGC
GACCGCAAGGTGCCGGTCTTGGTGCTGTAAAGGAGAAGTCGGAAAAGGAACGTCAGGAAGAAAAGCGTCAGGCACGGTTA
CGGGGAGAAGCTGTGGTACAATCGGATGATGATGAAAAACCGGCCAAAGCAGCAGCACGGAAGAAGAGAGCTATGGGCCT
CAGCGGCAGCGGCAGAACGACAAGTAGCGACACAGGCACACCGCGGCGCCAGAAACCCAAATACATGACAATGGAGGAAG
CCAAGCGGGCAGCGCCCGGCCTAGACATACCAGACACATTCACGCCGATCCTGGACCTTACAGGCCCGGGTCGGAGGCTC
CTCACGTCTTCATCTGGCCTCATGACACCGACCGCTGGTGCAATGTACGACGAAGCTGCAGCCGAAGATACGGCGGAGCG
GACGAAATCACGAAAGCTTGCGCGGCGTGCCCAGGCGGACTTCATGGCCATTTTAGAAGAGTGGCAGAGCCTGCAGAACC
GCAAGGCGTACGCGGAGCTGCAAGCGCAGCAGGTGCGGCAAGAACTTTCTGAGCTTACTGATAACCTATATGGCCACAAG
ACTATGGCAGAGGCATTCGCAAGGCTGTCTATTGTCGACGAGGTGGCTCCTTGGAAGGAAAGATGGGACCGCACGATAGC
ACAACTGACGGCGGCGGCAGCAGCCATGCCGATACGACCATCTGACGAAATGCGAGACGCACTGGCCCACATCAGCATTG
CAGCAATCCACCCGCTGCTGAAGCAAGTGGCTGAATCGTGGGAGCCGCTGCAGGATACAGGCAAGACCTTGGCGGTGGGC
CTCGCCTCGGTCCAGAGCCTCGTTAGTCGAAAGACACAAGACGAGTTGCCGCCGCAGCACTATCGCAGCAGGGCCATCGC
GTCGCCATACGAGACAATGATGTACAAGATTTGGCTACCGCCAGTGTCGCGAGCGGTGCGGAGGTGGGATGTGCAGGAAA
CAGACAGTCTTCTAGAGCTCTACTTGACGTGGGAGCCGCAACTGCCCGGCTTTGTGCGGGCGCAGCTTCTGGAGCAGGAC
ATTGTGCGCAAGCTAGAAGAGGCGGTGGTGAAGTGGGAGCCCAAACGCAGACGATATCAAACGCAGAACCAGAGCCTGCC
ACACCTGTGGCTGTTCCCATGGTTGCCCTACCTACCGTCTCGGCAGCTGGACCCCAAAAGTGCGGACGGTCTTGTAACGG
AAGTCAAGCGCAAGTTCCGGCAGCTGGTGCACGTGTGGGAGTTCTACCGCGGCGTGATCCCCGGCCTGCGAGAGTGGCGC
GATATGCTACGGCCGACTGCGGACAACGACCAATGGCGGCCGCTAGTCATGGCGCACGTGCTGCCAAGCATGGCGAGCTA
TGTGCGGGCGCAATTCCGTGTGGATCCCCGCGACCAGGCGCCGTACCTCGAGGTGATCACGGGCGAATTTCAATGGCTGG
GTCTGGTGGCTGCCGAGCTGGTTGGCGAGGTTATGGTGGCGGAGGTATTCCCGATGTGGCACGAGACGTTGTATCAGTTG
CTGACTACGCCGGGGCTGGCCAGTCTCGACCGGATTGCGCAGTGGCTTCAGTGGTGGGCTGACGAGGCGTTCCCGGCGCC
CATACGGCAATTGTCCTCGGTGGCGGCAGAGTTCGAGCGAGGAATGGTGATGATCAATGAGGCGTTAGACCTTGGCGGCA
ATCCTGACCTTGTTCGGCTCGCTCTGACACCACCACAGAAAGGCCCGACGCTGCGGGTAGAAGGGCCGGCGGCGACAACT
TTGCGAGACAATCGCCATCATGCGAGCCACCGGTATCGCAGTCAACAGGAACATCACCACCGCCATCATCATCGCTCCAT
CGGCCGTGCAGGTACATCACCAACCACTGCAGCAGTGACTTCGGTGTCGGGTGCCGGTGACCACGAGGAGATGTCAATAA
GGCACTACGTCGAGGACTGGTGCGAAACAAACGACCTGCAGTTCGTGCCGGAGCGCAAGAAGGTGCACGCAGAAGGTCCG
CTGTACCGTATCACAGCGCGTGGTGACGGTAAGGGCGGCGTGCTGGCGTACTTCAAGGGCCTGCGGCTGTACGTGGAAAC
GAAGAAGGGTCCTGTAGAGGTTCGAGTGGACCGAGAGGAAGATTGGGTGCAGCTACTATCAATGGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62