GenePrediction:GLEAN_5059 Details

Name: GLEAN_5059
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:2083460..2082122 (- strand)
Length: 1339
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:2083460..2082224 (- strand)
Length: 1237
Type: CDS
Source: GLEAN
Position: GCSC_97:2082147..2082122 (- strand)
Length: 26
>GLEAN_5059 class=GenePrediction position=GCSC_97:2083460..2082122 (- strand)
ATGTGGAACGGCGGCTACCAGCAAGGCGGTGGCTATCAGCAAGGTTCCTACGGCGGACCTCCTCCGAATGCATTCCCGCC
GCCACACGGCCCGCCACCACCGGGCTATGATGGATACGGTTATCCCCAGCAGCAAGGCCACGGCGGTCAGCCGGGCTACG
GTAGTCAGCCGGGTTACGGTGGCCAACCGGGCTACGGTGGCCAACCGGGCTACGGTGGCCAGCAGGCTTATGGTGGCCAG
CAAGGATACGGACAGCAGCAACAGCAAGGCTACAGCCATCAAACCCGTGGTGCGCAAGCTCCGCCGTCTGGCGAACAGCA
GTTCGGCCATGGCGCCCCTTCGGAGTACACCTTCCAGTACAGTAATTGCACAGGTCGCCGCAAAGCCCTGCTTATTGGCA
TAAACTACATTGGCTCTGACAACGCCTTGAACGGCTGCATCAACGACACTAAGAATGTGTCTAATTTCCTTATGCAGCAC
TACCATTACAAGCGCCAGGATATGGTTATTCTGACTGACGACCAAAGCGACCCTGTCCTGATACCCACAAAGGCCAACAT
GATCCGCGCCATGCAGTGGCTCGTCGACGGCGCCCAACCCAACGACGCGCTTTTCCTGCACTACTCTGGTCATGGAGGCC
AGACCGAGGACCTCGACGGCGATGAAGACGACGGCTTTGACGAGGTCATCTACCCTGTCGACTTCAAACAGGCCGGTCAC
ATTGTCGACGATGAGATTCACCACTACGTCGTAAAGCCTCTGCAGGCCGGTGTGCGCCTGACAGCCATCTTCGACTCGTG
TCACTCCGGTTCCGTCATGGACCTCCCCTACATCTACTCCACTAAGGGCGCGCTCAAGGAACCCAACCTGGCCGAGGAGG
CTGGTAAGGGCCTTCTAGGGGTCATTTCTGCCTATGCTCAAGGAAATATGTCAGGGGTTGCATCCAGTATCCTAGGCTTT
GCCAAATCTGCCTACCGCGGTGACGACGCGTACAAGCGCACTGTCCAAACCCGCACGTCGCCCGCCGATGTCATAATGTG
GTCCGGCAGCAAGGACGATCAAACCAGCGCCGACGCCACCATCGCATCGAAAGCTACTGGTGCCATGTCTTGGGCCTTTA
TCTCCGCCCTGCAGCAGAATCCGCAGCAGAGCTACGTGCAGTTGCTTAACAGTATTCGCGAAGTGTTACAGACCAAGTAC
ACCCAGAAGCCCCAGCTATCCTGCAGTCATCCTTTAGGTACGTCGCCATTGATTTCTCTGGGCTTTATTTCATTCTTATT
TGGTCGTGGCTGTTCTTACTAACAAGCGCTCAGATGTCAATCTTCTCTTCGTCATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62