GenePrediction:GLEAN_505 Details

Name: GLEAN_505
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:207062..214862 (+ strand)
Length: 7801
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:207062..207195 (+ strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_97:207258..214401 (+ strand)
Length: 7144
Type: CDS
Source: GLEAN
Position: GCSC_97:214479..214862 (+ strand)
Length: 384
>GLEAN_505 class=GenePrediction position=GCSC_97:207062..214862 (+ strand)
ATGGACTTTGACGCCAGCCTGTCGCCGGACGACAGCCTCGACCCCCCGGTGCGCCTCTTTGAACGGCTCCACCAGATCGC
TGGGTACTCGTGGGACGAGACCCCAAAGCCGTACCATTCAAGCTACGACAACTGGTACGTCACGACGGCCGTCATTCGTT
CGTGCTGTGGACTGACTAACTCTTCCTCCTCGCCAGGCACGTGTTCGGCACGCGCTTTATCTCTCCGTTCTCGACGTCGT
CTGGCCTGCCCACTGGCTTGCGCCATGCTTCCACGTGGTCACCCGTTGCCAGGGCCTCGTCTAGCCGGGCCTCGCCTGCT
GAGCCGCCCGTCTTCTCTCCATCAGCAGGCGAATGGGTGGGCGACCATACCGGCAACGCATCGCCCTCAGCCAACTCGGC
CACGCCCGACCTTGCCAACTCGCCGGTCGTAGAGGAAGCCGTGGTGGCACGGGTGTCTTACCATGTCTTGCGGGAGGAGC
GGGCCTTCCACATTGTGACTAGCATGATCTCGAGCGGGGATCCGCACGGGGAGCACATTGCCAAGCCAATCGACTACCTG
CGGCTCAACCATCTCCCAGGCGACCGCGGGCCTCTCATCGTGGCCATATACCAGTTCCCGGGGACGAACGACCTGCCGAG
ATACATCGATCTCGGCCCCGCATTCTACTACGCCCACCGCAAGGGCGATGTCTGGGAGGCCAGCACCAAATCCCGCTATG
AGCTTGAGCCGCCCATCAGCCTGGATCACTTTCTCGACTTTGCCATTGGAGCGGCGCAATGCCTGGAGCTCATCCACCAC
AACCAGAACATCGTGCATGGAGAGATCCGCGGCGACGCCTTCCACTTTAACCAGGAGACAGGCAGGACGAAGCTGGTGTC
GTTCGGGTCGGGCGTGCGGTCCTTTGAGCACGGCCTGACGAGCACCGGCTGGTCTTCGCTCTCCCGAGAGCGAGGAGCCA
AGAACAAGCTTCTTTACATCAGCCCCGAGCAGACCGGCCGCATGCCGGCCGAGCCAGACTCCCGCACCGACATATACTCG
CTGGGGGTGCTATACTGGGTCATGCTCACGCAGCGCCCCGTCTACGAAGGAGACACGCCAATGGACATTGTGCAGGGCGT
GCTGGGGCGCCGGGTGCCGAACGTGTCGGCCGTGCGAATCGACATACCCGACGTGATTGGCCGCATCATCCAAAAGTGCA
CCGCCAAGAGCATCAGCGATAGATATCACTCTGCGAGCGGGTTGCGCCAAGACCTGGTCAAGGTGAAGGAGTGCCTCGCG
AGTGGCGACCTAGCCACGCTGAAGGACTGGCAGGTGGCCTCTCGTGATGTCTCGTCCTTCTTTCTGCTGCCCAACCTGAT
GATTGGCCGGGATGCACAGCGGAAGGCGCTCTTCAAGGTCATCGAGCGCGTGGCCAAGAGCCATGCCATGGACCAGAAAG
GCAAGGGCAACCGGTTTTCGGACAGCTCGAGCTTCTCCAACGACTTTGTCGACATTGTCGATGGGTCGAGCGACGGTGGA
GCAAGCTCTGGAGACGGTCCCAACTACCGGAGCGGCTCCTTCACCCAGACGGCTCCAACTGACGTCAAGTTCCGGGGCAG
CCTCCTCTCTGCTACGCAGTCGACCGACAATCTCACCGTGTCGGGAGACATGTCGTCGATCCATTCCAACGGGCCGCCGC
TCCGTCTTCCCCAGCGATCTTGGGAGTGGCATTCGTCCGTGTCGTTTGATCTCCGGAGCCCACTGGAAGGCTCCATGACC
GAGCGCGAATCGTCGCGCCATGCTGGGTCCATCGTGGCAGAGACGACGTCCAGCCTGTCACGGCAGCTCGGGTCGGCCAA
GTTTCGACGCCGCGGTCACTGTGAGATCATCATCGTCGAGGGTGCTGTGGGCGTGGGCAAGAGCTGCCTCATCCAGTCTG
TCATGACGGAAGCACGACGACGAGGCTACTGTGCGACGGCCAAGTTTGACAAGGCCAGGAAGGCTGCCTTCGGACCTCTT
CTCCACCTGCTCTCGTCCCTCTTCCGCCAGGTATGGGGTGAGCGAAACACGGACACGCCCTTTCACCAGGCCCTGAAGCA
GTATGTCCGGCCTGTGTGGCCGACGCTGCATCTGCTCCTGGGCCTGCCGGATTTCCTCTTCAATTCGGCAGACGGAGCAC
CCGTCCTGTTGCGCTCGCCGTGCAGCCAGCAGTTTGGGGCTCCACCCAGCAAGGGCACGCGGCCTGCGGACCTCAAACGT
GTCTCGTCGCCGGGACCGTCTTCATCGTCGTCGAGCATGGGCCCTAACAAGGGCAATTCTGCGGGCGGCAACCCGTCGCG
AATGTCCGGCTCGAGCTCGCAGGAGTTTTTGAGGGCCGGCACGTCGACCAAGTCCATTCGGCTGATGAACACAATCCTCG
ATGTTCTGCGCATGTTCACGAGCCACAAGTTTATCTGCTTCGTCCTGGACGACCTGCACTTTGCCGATGCCGAGTCGCTG
GAGATGATTACTCAGATCATCAGCGCACGTCTGCACATGGTGCTCATCATCTCATGCCGGCCGGACGGCACGGCTCGCAG
CAATATTCAGAGCATACTGAGCCCGCTCGAACTGGACAGAGATGCGCCAAAGGGCAGTCAGACGGTGACGCGTGTTGAGC
TCGGCCCTCTTGCCGAGCAGGACATTGTCAAGTATGTAGCCCTGACGCTCAGCCGATCGGAGCAAGAGGTCATGCCACTG
TCGCTGGTGCTGCAGGCAAAGACGGCGGGCAACCCGTTCTACATGAGGGAGATGCTCAGCGCGTGCTACCGACGGAAGTG
CATCTGGTACGACTACCGCGAGTCGCAGTGGGCTTACGACATGAACCGGGTGTTTGAGCAGTTCCAGGGCGACAGGCACT
ACGACATCCTGGACACGGACTTTATCACGAACCGGCTCAAGGAGCTCCCGGCGGCAACGCGCTCGATTCTCGGCTGGGCT
GCGCTTCTGGGGAACGCGTTCTCCTTCGGGATGATCTGCCATCTCCTGAGCGGCGAGTTCAACTACATCGACGAGACGTG
TCCGGAGCCGCTGAGCACGCACGTGCACACGGCGTATTCGCAGCAGGACGCGGTAGCCGGTCTGCAGGTGGCGATCCAGG
CGTGCGTGATCGTGCAGAGCGAGACGGACGACCGGTTCCGGTTTGCGCACGACCGGTACATCCAGGCCTCGATGGACATG
AAGGTGTGCAGTGCCAAGAAGATGCACTTTGTGATTGCGCAGATGCTTCTGCGCTACTACAACGACGACGTGGACACGCG
CGACAGCACGGCGTCGCACATCTGCGAGGCGATGGAGGTGATCAAGGCGCGGGTGCACCGGCGACAGGCGTATCGCAAGC
TGCTGTGCGACTGCGGCCGCTCAGCGACGGAGAACGGGGCGCGGTCGACGGCGGCCAAGTACTACAGCAACGCGGTGTCG
CTGCTGCAGCCAGACGGATGGAGAGACGACGGCGACGACGTGTCGTACGAAGAGACGATCCAGCTGTACCTCCGGGCGGC
CGAGTGCTATCTCTACATGAACCAGTACGCGCTGGCCAACGAGATCCTGACGACGATCCTAGCCAACGCAAGGTCGGCAT
TCGACAAGGCGCCAGCATGGGTTCTGCAGTCGCGCATCTTTGCCCAGAGCGGCAACCCGATCAAGGCGCTGTCGTCGCTC
CGGGAATGTCTGCAGGCGATGGACGTGCGCGTGCGAGACGAGCCGACATATGAGCAGTGCGATGCCGAGTTCGAGAAGCT
CTCGGTTCGGATCCAAGGCATGGGGCGCAGCGAGGTGCTCAACCCGCCGACGACCAACGATGCGGCGACGGTGTCGGTGG
GCGCGGTGCTGGCCGAGGCGCTGAGCACGAGCTTGTGGACGGACAACCTCTACATCTACCACGTTGCGCAGGCGATGGTC
AACATGCACCTGACGCTGGGGCCGTTTCCGCAGTCCGGACTGGGCTTCCTGTACCTGGCCATCATGGCGATCACGCGGTT
CGGGATGATCCGGTTTGCGTCGGACCTGGGCGACTATGCGCTGGAGCTGCTGGATCGGTTCCGCGACCCTTACTGCATGG
CGCGCGGCTACATCCTGTATGCCGGCTTTGTGGGCCACGTCCACTACCCCCTGGCGCTGACGGTCACGCAGCTGGAAGGG
TCGCTGGAGTATGGGGCGGCATCGGCGGACCGGATGTCGGCGATTCTCAACTTCGGGGTGGCGGCCATGATCAAGTTCTT
TGCGAGCGAGAACCTGTCGGACCTCGAGGGCTTCTGCGAGTACTGCTGCGAGGACATTGCGAGCTGGCACCTGGACACGC
AGGGCGGCACTTTGCTGGTGGCAGTGCGCCAGTGCAGCCGGGCGTTGCAGGGGAAGACACACACGCAGGAAGCGCTGGAC
GTGATGAGCGACGAGCAGCACGACGCGGCCGCGTACAAGAAGTGGCTCGCGGCGCACTCGTGCAACGGGGAGCGGTCGCT
GGTGTTCTACGAGTCGATGGAGCTGGTGCCGCTGTATCTGTACGGGCACTACGACCGGGCGCTGGAGTTGGGCCAGCGTT
GTCTGGGCCGGGGCCGGCTGATGCTATCGGCGCGGAACACACGGCTGGTGATGCTCTTTTACGGGCTGGCGCTGGCCGGA
CTGGTGCTCCGGCGGCAGCAGGACCCGCGGCGACGACGCGACGGCGACGGCGTGGTGGAGGAGCAAGACCGGACGGAAGA
CACGATCCTGAAGCTGCAGGAGCTGCGCAAGGGCATACAGGACTGGTCGGACGTGTCGGACATCAACTACCTGGCCTGGT
CGACGCTGCTGGACGCACAGATCTCGGAGCTCAGCAACGACGTCGGCCGTGCGCTGCGGCAGTACGAAGAGGCGCTGGAC
CACTCGTCGGAACACAGCTTCATCTTCGAGGAGGCGCTGGGCAACTACCTGATGGCGGGCGTGTTTATCCGCAGGGCAGC
GCGGCGGTCTGCACGTGCGGCTCTGCGCGATGCCGTCGGGCTGTACCTGCAGGTCGGGGCGTCGGGCGTGGTCGGGCGGA
TCGAAGAAGAACACAGCTTCCTGCTGCGAAGCCCACTGAAGAACCCACGGACAGTCGACGCGGCAGTGCAGACAGACTTT
GCGACGGACCACACGTCAGTGCACTACGACGGCATCGGCGGCGGCGGCGAGATGGACCAGCAGACGAACAGCGACATTCT
CGAGACGGGTCGGCCGAGCCATCTGTCGGGGATCCGGGGCGAGCGAATCGGCGTGTGGCGAGGGGCAATGCAGGCCGAAG
CCGAGACGGGCATCGGCGGACTGCCGGCACTGGACATGATCGACCTGCACGCGATCCTGCAGTCGTCCCAGGTGATCTCG
TCGGTGCTGCGGGTGGACGAGCTGCTGAAGACGATGTGCGATGTGATCCTGCAGACGTGCGGCGGGTCAGCGACCCAAGC
AGCGATCATCGTGCAGGACGAAGACGAGGCAGAGTGGTGTGTGGCGGCAAGCGGTGATCCGGAGCGCAAGGCGGTGGCAC
ACATGCCGGGGATTCCGCTGACAGGGACGCGGATCGTGGCGGAGAACGTGGTGCTGTACAGCCTGCGATTCCGGGAGTCG
GTGTTTGTGGCCGATCTGATCAGCGACGAGCGGTTCGGCAACGTCAGCGAGCAGTGGCTGCAGCAGAAGAAGCAGCAGAG
CCGGTCGGTGATCTCGATCCCGATCTGCCACGCATCGAACCCGCTGATGGGGGTGCTGTACCTGGAGGGGGTGCAGGGAG
CGTTTACGGACCGGAACGTGACGGTGCTGCAGCTGCTGGTCAACCAGATCGGCATCAGCTACTCGAACGCGCTGTCGATG
AAGGCGACGGAGAAGGTGTCGGCCGAGAACCGGTCGATGGTGGTGTTGCAGAAGACAGCGCTGCGCAAGGCGATCGAGGC
AGAGAACAAGGCGAAGGAGGCAGAGAACAAGGCGAAGCAGAACCTGCAGCTGGCCGAGGCAGCAGAGGCAGAGGCGAAGC
GGAACGTCAAGGTAGCGGAAGAGGCGACCAAGGCCAAGTCGATATTTCTGGCGAACGTGTCGCACGAGCTGCGGACGCCA
CTGAACGGCGTGATTGGCAACTCGGAGCTGCTGCGGGACAGCAGCCTGACGGCAGAGCAGCAGGAGATGGCGGAGGCGAT
TCGGCTGTCGGCAGACCTGCTGCTGATCGTGATCAACGACATCCTAGACTTTTCGCGGATGGAGGCCGACAAGATGAAGC
TGTACATCACCGCGTTCAACCCGCGGGAGCTGATGCCGGAGGTGGTGCGAGCGGCGTCGTACCGAAACCAGGAGAAGACG
CGGGAGGGCGCGGTGGCGATCGAGAAGCAGATCCGGCTGCCACCGTCGCTGTTTGTGTACGGCGACCCGGTGCGGCTGCA
CCAGGTGCTGGGCAACCTGATCGGCAACAGCATCAAGTTCACGGAGCGCGGCACGATCACGGTGGGCGCACGGGTCGAGT
CGGAGACGGCGGCGACGGTGACGCTGACGTTCTGGGTCGAGGACACGGGCATCGGCATCCAGCCGGACCAGCTGGCCAAC
CTGTTCCAGCCCTTCAGCCAGGCGGACCCGAGCACGGCGCGCAAGTACGGTGGCAGTGGGCTCGGCCTCAGCATCTGCAA
GTCGCTGATCGAGCTGATCATGAAGGGCAGGATCTATCTCGAGAGCACACAGCACGTCGGGACCAAGGTCTGGTTCACCG
TTACCTTTGACAAGGCCACGGAGAAGGGGCTGTTGGGAGGGGTGTCGCCGGCCACGGTGGCGGCATCATCACCAGGTGGA
GGGGGGAGTGGGAGAGAAGGGGGGGATGGAAGAGAAGGAAGAGAAGGAAGAGAAAAGAGAGGGGCGACTGACCCGACTGA
CCCGACCGAACCGACAGAAACCCACACGGCACACACCACGCCCTACATGGACCTCAGCGGGATCGACCAGGACCAGCTGC
GGGTATGCATTGCGGAAGACAACCCGATCAACCGCAAGATTGCGATCCAGTACGTGCAGAGGCTCGGGTACCAGACCGTG
GACGCGTACGAGAACGGGCAGATGGCGGTGGAGGCGCTGCGGCAGAAGGCGCTCGAGGGCCGGCCGTACCACGTCCTGTT
GATGGACGTGCAGATGCCCGTACTGGACGGCTACGAGGCGACGAAGTTGCTGCGCAGAGACCCCCTGCGAGCCGTGCGCG
AGGTGCTGGTGATCGCCATGACGGCGTCGGCCATCCAGGGCGATCGCGAAAAGTGTCTGGCCGCGGGCATGAACGACTAT
CTGGCGAAGCCGGTCAAGTCGGACGTGTTGCGGCGGAAGCTGGACGTATACATTGGCGTGGTGAGTGGGAGAGAGAGAGA
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAAAAGTGCTAACATACACAGCGACACCCAGACAAACCGAGAGA
CTCCGAAAACATAGATCCACAGCCGACAGACGATGCCAACTCGACAGAGACAACGCCGACAAAGAAGCTGTTCAAAATCC
TGCAGTCCAAGAGCCGGCTCTCGAACGAGGCGGTGCCAGACCGGCCAAAGTCGAGCCCGTCGGTGCTACAGAAGAAGAAC
CCGCTGCTCCGACCGGATCAGGGACCAGAAGGGACGGACGGGAACGGCAGCAGCGGCAGCGGCGAGTCGTCAGCAGCGAA
CCGGCCGGCTGGGAGACAGAGAAGCCTGAGCATTGCATCGATGATCAGCTCGCGGAGCAAAGGCCAAAAGGGGGGGGATA
CCGGAGGAGAGGAGGGCGAGTACAAGAGAGGACGCGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62