GenePrediction:GLEAN_5060 Details

Name: GLEAN_5060
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:2077205..2076357 (- strand)
Length: 849
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:2077205..2077088 (- strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_97:2076996..2076731 (- strand)
Length: 266
Type: CDS
Source: GLEAN
Position: GCSC_97:2076659..2076357 (- strand)
Length: 303
>GLEAN_5060 class=GenePrediction position=GCSC_97:2077205..2076357 (- strand)
ATGACGTCGCTACTTCGTTCTTCTGTCCTCCGGGGCGCCATGCGTGTTCGGCCTTCTGCTACTGCTACCATGAGCACCAC
TTTTGTCCGCACGAAGGCCACTCTCCCGGATCTTTCGTGTAAGAAAAAAAAAGCCCTAGGCCATTATCTACTATTGCTTG
ACCGTGTTTGCAGCAACCGACTGACCTGCACTTTTTCCGTTCAAATTAGACGACTATGGTGCTCTCGAGCCGTACATTTC
GGGCAAGATTATGGAGCTTCACCATAGCAAGCACCACCAAACCTATGTCAATGGCCTGAACTCTGCGCTCGCAACTATTG
ACGAAGCTGAGGCCAAGGGCGACTTCCATAAGGCAGCCCAAGTGGCACCCCTCCTCAATTTTCACGGCGGCGGCCACATC
AACCACACTCTTTTCTGGGAGAACTTGGCGCCTGCCAGCCGTGATGGCGGCGGAAGCCCAGATGGAAAGCTTAAGGTGCA
CTCTACATATCATATCGCTTACATCATATCGCGGTGGCCTGCTGACAGCATCCCCTACTTGCCTAGTTTGCAATCGAAAA
AGACTTCGGTTCTACAGAGGTCCTCGTCAAGGACTTTAACGCTGCCCTCGCCGGTATTCAGGGCAGCGGCTGGGCTTGGC
TCGCTAAGGACAAGGCCTCGAACACGTTAACTCTGGTTACTCGTGCAAACCAGGACCCGGTGTCGGGAACGCTCGTCCCG
CTGCTAGGCATTGACGCGTGGGAGCATGCCTACTACCTTCAGTACGAAAACCGCAAAGCTGAATACTTCTCAGCAATTTG
GAATGTGATCAACTGGAAAACAGTAGCCAAACGATTCGAGAAGGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62