GenePrediction:GLEAN_5061 Details

Name: GLEAN_5061
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:2073021..2070711 (- strand)
Length: 2311
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:2073021..2072911 (- strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_97:2072836..2072170 (- strand)
Length: 667
Type: CDS
Source: GLEAN
Position: GCSC_97:2072093..2071891 (- strand)
Length: 203
Type: CDS
Source: GLEAN
Position: GCSC_97:2071829..2070711 (- strand)
Length: 1119
>GLEAN_5061 class=GenePrediction position=GCSC_97:2073021..2070711 (- strand)
ATGCCGAACTCAAAAAACATCCGCAAATTTTCCACGGGCACTTCCGTGCACCGGAAGAGGCGGATGAGCACAGTGGCCGA
GAAGGAAGGCTTCTTTGGTCCAGCATTGACAGTAAGACATTCACGTTCTAATTTCTGTCGCCATCGTCGCTTGTTTTTGA
TGGGAAAGTGCTAACATTGAACCAGACCCTGTACATCGGAATATCTGCTGTTTTTGCAGACGACCATACTGCCGTGGTAG
CCCTTGCCATCCATGACACTGTTTACCTAGTCGACTTTTCCGTCAGACGCATTGAACTGGACGATGCTCTTCGTACGGGT
GATGACCTTATTGCCGAACACATCATTTCCGACATCAGGAAATATGAGCTTGAAAACTTTGCAAAGTTCATTGGTGCCGG
GTTGCCGGCAACGCTCAAGTACATGAGTCCGTCTTTATGTTCCCGGCTGTGGCTTGAGTTGGACATAATCCCAATTGTTA
TCCGTCCCGATGACGAGAGTAAAGAGAAAAACTTCTGGGATGCCAAGCGCGTCGATGAGCAGGCCGATTCCATGGCTCGG
AAGTGCATCCTGAATTTTAGCCCATCTTTGGTGCCCATTCTTCAAGTTGGCTGGCGTGGTGTTGTCCAGACCGACGCAGG
CTTCCGCGCCCAGCTCACGACCATCCAGGACTACAAGGACACGTGTGGCGCGGCCACATGGAACGCCATGATGGTGTTTG
CCAAGCAGCTCCGGAGCGAAAAGACCAAGATTGCTTTTTTCAGCAGCACTCCCCAGGGAGGTGGAGTCGCTTTGATGCGT
CATGCACTCGTCCGTTTCGCTCGTCTTCTGGGCGTCGACCTGACGTGGTATGGTAAGTATTGGTGAACAGTTGATATACT
TCATTTGTACCCGCCTCGTCAAACACACGGAAACTAACAAGGAGGCAGTTCCGAAACCGCGCCCTGGCGTGTTCCGCATC
ACCAAGAACATGCACAACATCCTTCAGGGAGTCAGCCATCCCGACCAACGGATTTCGCCTGAAGAGAAGGCGTCCATTAT
TGATTGGATTTCCGAGAATGCAAACCGCTACTGGTTCTCGGAAGGTGGCCCTCTCCGTCCGGCCGAAGAGGGCGGCGCTG
ATGTTGTCATGGTAGGTGATACTGATACCACTTTTTTTCTTGTTTGCTCGATACGTCTGACAACGATTTCAGATCGACGA
CCCTCAGATGCCTGGTATCATTCCGATGATCAAGCGCCTGACGCCCAACCGACCGGTTCTGTACCGGTCGCACATCCAGA
TTCGCAGCGACCTTGTTGCGGTGCCGGGCTCGCCGCAGGAAGACATCTGGAATTTTCTGTGGAGCAACATCAAGGAGGCC
GACATGTTTATCAGCCACCCGATTCCCGCATTCGTCCCTCATACTGTCCCGGTAGAAAAGAGGGTCTACTTCCCAGCGAC
CACGGACTGGCTCGATGGCCTGAACAAGCCCATAATCAGCTGGGACACCGGGTACTACGGCCATATTTACAACACCGCTT
GTCACTCGCAGCGAATGACGGAGCTCAACTGGCCCGCGCGCAAGTATATTGCCCAAGTTGCGCGATTTGATCCTGCCAAG
GGCATCCCGACTGTCATTGACTCGTACGCTGAATTTCGCCGGCTGCTTGAGAAGGCTGGGGTAGAAGACACCCCCCAACT
TGTGGTATGCGGCAACGGCTCTATCGATGACCCGGACGGTTCCATGATTTACGACCAGACGATGAACCAGCTGGAGACGC
ACTACCCGCATCTCATAGACGATGTCAGCATTATGCGCCTTGATCCCAACGACCAGCTCCTCAACACCATCATAGCTCAT
GCGCACGTTGTCCTTCAACTGTCGACTCGGGAGGGCTTCGAAGTCAAGGTTTCGGAGGCGCTGCATGCTGGTCGCCCAGT
CATTGCGACGCTCGCCGGTGGAATTCCGCTTCAGGTGAAGGACAAGGTGAACGGCTTCTTGGTCCAGCCCGGAGATTGGA
AAGCAGTCGCTGGCCACCTGATGCAGCTGTTCACGGATGATGACCTGCACTCTTCGATGAGTTATGCGGCCGAGACAGGC
GTCTCGGACGAGGTTGGCACCGTGGGCAATGCTCTCGGCTGGTTCTACCTGGCGGCTAAGTGGAACAAGGTTGGCGTCAA
GAAGGCAGGTAAGGGAGGCATTGCAGGACACGAAAAGTGGGTGAACGACATGGCCCGCGACGAGGCCGGGGTCCCGTACA
CGGAGGAGGAGAACCGGCTTCCACGCCATTTTACCGAGAGAGTCCCAGAGCAGGAGGAGGCGGCTTCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62