GenePrediction:GLEAN_5065 Details

Name: GLEAN_5065
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:2014229..2010954 (- strand)
Length: 3276
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:2014229..2014193 (- strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_97:2014127..2014049 (- strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_97:2013988..2011045 (- strand)
Length: 2944
Type: CDS
Source: GLEAN
Position: GCSC_97:2010989..2010954 (- strand)
Length: 36
>GLEAN_5065 class=GenePrediction position=GCSC_97:2014229..2010954 (- strand)
ATGGCGAGCAAGAAAGTGCGGCAAAAAATCAGCTATGGTACGGACCTGTGGAATCTAGTTTGGACATCTCGTTTCTTGTG
GGAGTGCTTACTGATCATGTAGTCCTCGAGATCGACCCGCTGTCGGTCGGCCACCGGCTGGGGGTGAACGGCCTGGCTTA
CGACAGCGACAACTCCATCTTGTGAGGCCAAATGTCCGAGCTGTTCTCGAAGCCCCCCATAGCTAACGTATGCATATTCA
GGTATTCTGGCGGCCGCGATGGCGTAGTGTGTGCGTGGGACATGCACCTCGACCAGCCGAAGACATCAAGCGACGCCGAC
AAGGCCAACGATAACGATACGGCACCGAAGCCAGTGCAGGCCGCAGATACGACCACCGACGGATCGCCGCCCAAGCCGGC
TGTTTCCCCCGCACGACAGACGGCGACGTCCCGCGCGCAGACACAAGCGCACATGCACTGGATTAACGACATTGTCTTGG
CGCAGAACAACTCAGTGCTGGTGACGGCGTCGTCAGACCTGCTGGTGAAGGCGTGGAGGCCGCGGGCCGGTGATAACAAC
GACGAACCAGCGATCCTAGGTCGGCACGAGGACTACGCCAAGTGCGTGGCGTCGCCGGGGCAGCAGGCGACATGGGTGGC
GTCGGGCGGGCTGGACCGGCGCATCCGGCTGTGGGACCTGCAGGGTGGTGGCAACACGAACCAGATTCTGGAGATTGATG
TCAGCGGCGAGGAGCGGGCGGAAAAGGGGTCCGTGTATGCGTTGCGGGCGACACACAGCCTGCTCGCCAGCGGCGGGCCC
GAGTCGACGGTACGGCTATGGGACCCGCGGACAGGCAAGAACATCACCAAGTTTGTCGGCCACACAGACAACGTGCGGGC
GATCCTGATCAACGGGGCAGGCGACACGGTGCTGACGGCCAGCTCAGACCAGACAGTCAAGGTGTGGAGCGTGACGGCCG
GTCGCTGTATGCACACGCTGACGATGCACAACGACAGTGTCTGGTCGCTGTATGCAGATCGTCCGGACCTGGGCATCTTT
TACAGCGGTGACCGGTCTGGGCTCGTGGTCAAGACAGATGTGCGTGGCAGCCTCAATGACATGGACGCCGGCTTCTCAGT
GGCTGTGGCGCAAGAACACGGTGGAGTCAACAAGGTGGTCGCTAGCGATGGCTTCATCTGGACATCGACATCGAGCTCGT
CGATCAACCGATGGCGAGATGTCGACACGGGTGCGGCGCTGCAGCGGTTACAACAGCAGCAGCTGCAACAGTCACCGCGG
CCGTTTTCGCCGGCAGACACGATGCGTCCGCACAGCTCTTCCGTGTCGACGGTGAAGTCGGGTGGTGGCGGTGGTGGCAT
TGCGACGTTAGCTGTGGCGGTGACGGCCGGCCCAGAGATTCCCCCGCGGTCGATCCTGCGCATCTCCAACACGGCGACGT
TTCCGCGGTTGGTCTCGACCGATACTCTCACGTTGTCGGGCAGCAGCGTGCACGGACGCAAGAACTCGGAGGTGGCGACA
ATGGCAGACGAGGAGACTGCGACGGCCGAAGAGGTTGGCATCGAGCCGATCCAGCGGCTTCCGGTAGAGACGATCGAGGG
CAACTTCGGACTTGTCAAGCACCGGCTGCTGAACGACAGGCGGCGAGCACTGACGCTGGACACGGCGGGTGAGGTGCTGC
TGTGGGATCTGATCCGCTGCAAGCAGCTGCGTCGGTTCGGCAAGAGACACCTCGAAGATGTGGAGCCGGAGGTCAACACG
ACGGAGGCGGTGGCGCCGTGGTGCTCGATCGACGTCAGTTCGGGAAATCTGATGGTGGTGCTGGATGCGTACAACTGCTT
CGATGCCGAGATGTATGCGGACGAGCTCGTGCTGGACGAGCCGTTTGCATTCCGCGAGGACCAACGGATCAATCTGGGCA
AGTGGATTCTGCGATACCTGTTTGCCAACCTGATCGATGAGGAGGTACGGCGCGACGACGTGTATCTTGCCAAGATCAAC
GAAGTGATCGACAAGCGTATCGAAGCAGCAGCGTTGGCGGCAGCGGCAGCAGCCGAGGCGGCGGCGATGAGCATGCTGGA
CGTGGGAAGCAACGGCAGCGACGGGACGGGCGACAAGCGTGGGTCGCAAGCGAGCAGGTCGTCGGCGGAGCGGGAAGAGA
ACGGGCTGAACGGAACGTCGTCGAACGATGGTAGCAACGGTCCCGGGCTGTTTCTGAGCAAGACGACAACGGGATTTGCA
GGTGCCGAGGCATCCGATGGGGCCAAAGACGCAAACACGACAGCCAAGTCGCCGGGAACGCCGTTTGGCAAGAAGTTTCG
GATGGGCATGTCGTTTGGCACCAAGAAGCTGGGGCGGTCGGCGTCGACGAGCGTGCCGGAAAAGACGGCTGGAGCGGCTG
CAGGGGCGACACCAGCAGCAGGAGTGGACGGGACGGTGGAGGAGGGATTGGAGACAGGGTCGAGTTCGGCAGCAGATTCA
GATGCGTCATTCGTCGGGGTAGTGCAGCGGATGCGGGCTGAGTATGAACGACAGCTGGCGGCGACAGCAACGGCGACGGC
AGACCAGCAGACATTGGCGCGGGTGGAGTCGCGGATCACGCCGTGTCCGGTGGACGAAGCACCGCCTCTGCAGCTGCCGG
CCAACACAATGGTGATGATCCACGAAGAACTGCAGGGCGGCAGCATGGAGGTGTATCGGGGGACGATTGCGACGGCGGGA
CGGTCGCGTGACGTGGACAAGATCGAGCGGTGTGCGCCGCGATGGCTGGCAGAGGCGCTGCTGGCAAACAGCGCAGTGGG
AAAGGAGTCATACAAGGTGTCGTTTATCCTGTTGCCGTATCGGAAGGAGGGGGCGGCCGAGGCGACGTTGCCCAACGTGG
CGACACCAGACGGCAGCAGCCGGTTGAACGCGAATCGGATGCTGCGGGTGAAGAAGATCTTGGCGTATGTATCGGAGAAG
ATTGAAGGGCCAGTGGAGGGGGCGGAGCAGTCGGAAGCAGTACCGGGAGACGGAGAGGTGGGCGAGGAAAAAGGGGGGAC
GGAGAAGAAGGAGGAGTCTGTCGAGGTCGGAGAGGCTGCAGAGGCGACAGAAACTGGCCAAGGTGCAGAGATGGTGGAAA
CAGCCGAGACGAGCGGTCCAGTGCTGCGGCCAGAGGAGTATCTGGAGCTGTACTGCAACGAGCAGGTGAGTGAGAGATGT
GGAGATATGGAGATGTGGATGCTGGGATTTGGACACGAAGCTGACAGTGGCGAACAGCGTTTGCCGGACTCGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62