GenePrediction:GLEAN_5069 Details

Name: GLEAN_5069
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1994792..1993856 (- strand)
Length: 937
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1994792..1994557 (- strand)
Length: 236
Type: CDS
Source: GLEAN
Position: GCSC_97:1994447..1993856 (- strand)
Length: 592
>GLEAN_5069 class=GenePrediction position=GCSC_97:1994792..1993856 (- strand)
ATGGCCAACCCAAACGCTCTCTTCCTGCTTGCGGACCACATCAAGCTGTCGCTGCTGGAGCGTCAGCGCACCAAGGCACT
CGACCTGCTACAGGACACCACGGACGTCGCGGGCGACGACGGCAATGGATGCGATGCCCAAGACGGTCAGATCTCGCGGT
CGCTGGATCAGTTCCGCGACGGCCTGGAGGCGCTGCAGCGGGAGCAGACACGACTCGAGAGCAACGGTGAGGCAGGGTGA
GTGATGTTAGAAAGGGGAGAACAAGGGGAAGGAGAAGAGGGAAAGGAAAGATGGAAAGAAGGAAAGAAAGAGGCCCACAG
AGGAAACGGCTGACAATGTCTGCAGAAAAGCGCTCACAATTGCCGATGCGCTGCCTTCGCTGCAGAAGCAGCTCGCCACG
CTGACAGCCCAATTTCAGGGCGCGCCGCTTTCGTCGTCGTCTCCGGTGTCCTCCTCGCGCCGGCCTGCTGCTGCTGCTCC
GGCGGCAAAGAAGGCGGTCCGATTCCAGGACAAGCCGCTGCCACCGCCTCCCGGCGCTTCGGCCAGCGATCTCGACCTCG
AGGCCCAGCGGTCAGGCCTCTTCAACCAGCCGTACCACGACGAGCCTGACGACAGCAGCCGGTTCGCGTCCCAGGACAAC
CCCGAGCTGCTGCAGACGCACGCGCGCATCATCGCGGACCAGGACGCACAGCTCGATGTGCTCGGCGCCAGCATCAGCCG
CCAGCGCGAACTTAGCATGCAGATCGGCGACGAGCTCGACAGCCACGTCGCCATGCTCGAGGAGTCTGAGCGCCTCACCG
ACCGCCACCAGAATCGCATCGACCGCGCCCGCAACCACGTCGGCCGCCTCGCCCGCAACGGCAACGACTGCAAGCAGATG
GGCATCATCGTCTTCCTTATCGTCATCCTCATCCTTCTCATCGTCATTCTCAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62