GenePrediction:GLEAN_506 Details

Name: GLEAN_506
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:222497..223887 (+ strand)
Length: 1391
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:222497..223253 (+ strand)
Length: 757
Type: CDS
Source: GLEAN
Position: GCSC_97:223543..223609 (+ strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_97:223707..223887 (+ strand)
Length: 181
>GLEAN_506 class=GenePrediction position=GCSC_97:222497..223887 (+ strand)
ATGCGAGCGTGGCTCATCGCAAAGGCCGAGGAAGATAAACGCCGGGCTGAGCAAGAGCGAACCATGCAGGAGAACATCCG
ACTGGAACAGAGACGTACCGAGCACGAAATGCTGCGAACGTCCCTCAACGGCGGTATACCGCCTCCCATGGTGCCGATCG
TTTTTGCCGGCATGGCCGGTGGCAGCTTACCTCAGGCCGCACTCGAATGGGCACATCAATTTATGTTCCCTCATGGCCCG
CCACTGCCACCGCATTTGCAACAGCTTTCACCACAACTACAGCAACAGCAACAGCACCAGCAGCACCTCATCGCGGCCAG
CAGCCCTGGCCTTTCCGAGCTGCAACGTCGGAGTTCTCAAGCACTGCCACAGCCACCTCATCCGCCGCCGCCGCCGTCTC
AGGCACAGCAACTGCAGTTGCAGCAGCAGCAACTGTACGGACAACCGTACGGCGGAGGTGGCGGTGGACCGGGCGCACCG
GGCCTAGCACCTGGTCCAGTGCCGTCTTCGGGTGTGCAATTTGCGACGCAAAGTCCGGTGTCACCGTCTCGCGCGCGCGG
GTACAGCGTTCCAGGACCTGGCAACCGTCCGGGGATGGGAGGAGGGGCTTCCAACTTGCCGACTCTCAACACGAATGTTG
CCCACCCGCATGGACAACAACAGCCTGACTCGCAGGCCTCGCCGCTCTACATTCACCACTGGCAGCCGCCCTCGAGTCAG
GGGGGAAGTGGCTCCGGGCAGGCCAGTACTGCTCCAGGTTCGTCTCTTTTCTCCAGGTCCATGTGTCTGTAGCAACGTGG
ATTAACATGTGCAAAGGGGAATCGCCGAGAAAACGCAAAGCAACAGGCCCGCCGTCGGCTGCGGCACCGTCAAGCACACA
GCCCCGATTCCGATCGCCCACCATTTCCCACAGCTCGACATTGGCAAATCCGCCACCCGGACGCCGGCGAGGTCATACGC
GACAGCGAAGTGATCTGTCGTCGTACAGACCCCAAGGCAGAGGCGGATACGGCGGCAGCGGCAGTGGAAGTGGCGGCGGG
GGACAGTCCCGCGGGATATCGCCCTCGCCGTATTCGTCGGCACCACCGTCCGCGACCGGCTCATCGAGAGAGGGTGAGGA
AAGCAGTGCGACACGCGCGCAACAACAGGCTTCCCAGCCAGCTTCAATACCGCCACCACCACCACCACCGTTGCCGTTGC
AACCACGCAGCGGGGGCGGACATCCGGTGTCGTCGTTGCTGTCAGAAGATCCGCATCCGACGGGCGGATTGTCATACGGA
GCCGGAGGCGACAGCGAGCGTCATCGGTCACCTCGGTCTGGCCATCCCACAGACGATAAGGGCAGTACTGGAGGCACAAA
TGCAGGCGGCAACAGAGACGGAAAGGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62