GenePrediction:GLEAN_5070 Details

Name: GLEAN_5070
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1989382..1987876 (- strand)
Length: 1507
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1989382..1989374 (- strand)
Length: 9
Type: CDS
Source: GLEAN
Position: GCSC_97:1989317..1989213 (- strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_97:1989143..1988369 (- strand)
Length: 775
Type: CDS
Source: GLEAN
Position: GCSC_97:1988291..1987876 (- strand)
Length: 416
>GLEAN_5070 class=GenePrediction position=GCSC_97:1989382..1987876 (- strand)
ATGGCGAGTGTATGTGCTACTTTCTTGTTCGAACCCATAGGGGATATTTCTGACACGGTATTCAGCACGGAGTTGCACGC
GGCCCCCGGACTCGAACGGACGATCAGAAGCGGCAGGACGCAGAACGAATCAAGACCTATCGCGAGCTCGAGGACCAGCT
CCGACTCAGTGTAGGTGGCATGTCGTTTAAGTCATGTGGCCGTACGCACGACTTTTTCTGGCGGCTAAGCAGTCTGTAGG
ACGGCCACGGTACCGACGCATTCCAGCTGACGACGAAACTGCTGCGGCTCAACCCCGAGTACTACACGATATGGAACGTC
CGCAGGCGCTGCCTAATTTCTGGCTCTTTGTCCAGATGGCCCTCTGGGTCGCCGTCCTCGGAGGTCTTCTCGAGTTTATC
TCCATCCAGAGCAATATTACTCTCTTCCGGCGGATCATTGTCTACGTCCTCGGCCGCGACCCCGCCGAGCCGCCTTTCAA
CTGGAGAAACATCCGGGGAATCATCTGAGGGGGCAGAGGTGGGAGAAGAAGGAGGGGCGAGCAAGGTGACAAGCCGGGCG
GCAGACCATGCCAACGACGCACGGATAATCACAGCAGAGCTCCAGTTTACCATCCCTCTGCTCATGGAGTTCCCCAAGTG
CTACTGGATCTGGTCCTATCGCCTGTGGGTCCTGCAGCAGGCCGTGCAGAGGCTGGAAGCGCAGACGGCCCGGCGCATCT
GGGAAGACGAGCTGGCTCTCGACTCCAAGATGCTGACCAAGGACCGGCGCAACTTTCATGCCTGGGGATACCGGCGGCAG
GTGGTGGAACAGCTCGAGAGCCCGGCGCTCAGTCCAGCTGGTGCGGGTGGACCGCCCACGAGCTTAGTCGAGGCTGAGTT
CGCCTACACGACCAAGATGGTGCACATGGACCTGTCCAACTTCTCGGCCTGGCACAGCCGCAGCAAGCTGATCCCACGGC
TGTTGGAGGAGCGGCAGGCTGACGACCTCGCGCGTACACACTTTCTGGACTCGGGTATGTGAAGACGACCTTCCCTGTTG
TATTGCCACCTTCCCTCCCGCTCCTTTGCGCTGACCTGTGTGACCTGTCAGAACTCGGCATCGTCCGCGAGGCTCTTAAT
GTCGGCCCCGAGGATCAGTCACTTTGGTTCTACCACCAATTTTTAATGTCCAACCTGATCGACTACATCGGGCGGCCGAC
AATCACGCCACACTTCTCACACAAGGAGCGCATGACGTACGTTGTGCGCGAACTGGACGACATCAAAGACCTGTTGCTGG
ACTACGATGACATCAAGTGGATCTACGAGGCGCTGCTCGAGTACACTATTGCCGTGGCGAAGATGGAGGAGCGCCCGCTG
GCCGAGAACGAGATAATAGAGGCGCGAGCGTGGCTAGCTAAACTGAGAGAGCTGGATCCGATGCGCGGTGGCCGGTGGGA
TGACCTGGAGGCGGAGTACATCCTGCGACGGCGGCGGCCATTTGCCGAGGACGGGTTAGACATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62