GenePrediction:GLEAN_5071 Details

Name: GLEAN_5071
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1983636..1982023 (- strand)
Length: 1614
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1983636..1982023 (- strand)
Length: 1614
>GLEAN_5071 class=GenePrediction position=GCSC_97:1983636..1982023 (- strand)
ATGGCTTCCCTCGATGGCGACGACCGGTTTGCGAGGCTGGTAGTCTGGTCACAGTCACTTGGAGGCAGACTGCACGAGGC
GGCCGAGATTTATCGTGACGACGTGACCCAAATTTCGCTGAGAGTGCGGTCGAAAAATGGGGAAGAGAAGCAGCTTGAAT
CTGGCGAAGAGGCAATTTTTTGCCCGCTGTCGACTACCCTATCGTACCTGAACGCCCTCGAAGGAGGACGGCCGCTAGGT
TCCTCTGCCGCAGAAGAAGCAGGGCTATCTCCAGGCCGGCTGACTTTTCCGAACAGTTTCTTGGAGCAGGCTCCGCCGCA
TGTCATCGGCCGGTTCTTTCTCATGCAACAATACCTGATGGGCCAACAGTCGCACTGGCATGCATATATTGCATCTCTGC
CGCAGCCTGAGCATGTTAGCTCGTGGAACCTGCCGGCGCTGTGGCCACGGAACGGTGAGGATGCTGAAAGCGGCCCGGCC
CTGCTCGAGGGAACCAATGCAGGTATTGCTGCGGCAGAGATGCAAGCAAATGTGGCACAGGAGTACCGGCAGGCAAGGCG
GCTTTTGAAGAGCGTGGCGTATCCAGCGCTGGCCGAATTCACACGGCTGCTGTACCACTGGGCGTTTTGTATCTTCACCA
GTCGCAGCTTCCGGCCGTCGCTGGTGCTGAGTGCAGAGGCGCAGACAGAACTGGGGACCGATGGGGAGGCAAGCGGTGGC
CGAAGCGTCCCTCGGCTGTCCAGTGGCTGCAAGACGGACGACTTCTCTATTTTGCTGCCTGTGTTGGATCTGGCCAACCA
CGATCCGACAGCGAGGGCGACGTGGGAGGCGACGTCTGCCCACCTGGCCGACGGAAGCGCGTCTGGTCATGAGGCAGCAT
CCGTGACTGGTGTGAGCTTCCGCGTCCAGCAGCGATATGCACCTGGACAGCAGGTGTTCAATAACTACGGCATGAAGACC
AACAGCGAGCTGCTGCTGGGCTACGGGTTCGTGCTGCCTCCAACGGCGACCCTGCACAACGACTACGTCCATCTGCGGAA
GCGAGGAGCATCGGCTGCGGTCGCTGGGACGGAGGCCGGCACAGGTCAGCCGCGGGACTTTCTACTCTCGCTACGACCAA
TGGATGACTCCAGCTCCGTCGTGGGCGCCTCACGGCAGTGGCCGCGGCGCACGACCGTGGCTGGCGGCCTGCCCTCTGCA
TTCTCCCGCTTCGAGGACGCACTACTGTGGGACCTGTGCTCGCAGATGTGGACAGAGGCAGACAGGCAGCAGACACTGGG
ACTGGAGCCAGGTATGGAGGTGTCTATGGATGCGATACCGCTGGAGCAGCGGACCGCTGTTCTTGACCGTGTCTTCGCCG
CAGCATCGCCAGAACAGTTGAGTCCGTTCTCCGAACTCGAGGACAGGGCGCGCCAGACGCTCTTTGCAAAGGTGGCCATG
GACTATGAGCGACTGGCTGAGGGTGAGCAGTATGTGGCCGAGGAAGAGGATGTCGATGCGAGCGAGCGAGCAAACTGGCA
GCTGGCGCAGGCCTATCGACAGCAGTACGGAGCAGTACTGATCAATGCTTTAAAGACACTTGACCCAGAAGTCGAGTTAG
TGGAAGCACCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62