GenePrediction:GLEAN_5073 Details

Name: GLEAN_5073
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1972656..1970946 (- strand)
Length: 1711
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1972656..1972255 (- strand)
Length: 402
Type: CDS
Source: GLEAN
Position: GCSC_97:1972194..1971971 (- strand)
Length: 224
Type: CDS
Source: GLEAN
Position: GCSC_97:1971907..1971085 (- strand)
Length: 823
Type: CDS
Source: GLEAN
Position: GCSC_97:1971029..1970946 (- strand)
Length: 84
>GLEAN_5073 class=GenePrediction position=GCSC_97:1972656..1970946 (- strand)
ATGTCGTCGCCATCGATCAAGATCAGCTCGCTGCAGGAGAAGACGGTCCTAGAAAGCCACTCGGCGGAGAGCGGCGAGAC
CGAGGTGCCTGAGGACAATAGACGGGCACGCAAGTACTGGAAGCAGATGGCTGAGTCCAATTGGGTCGAGCTGCGCGGCA
TCCAGCGGGTGACGCCGGAAGAACAGCAGCTGCACGGCCGGCCGAACTATATGCAGATGGTGCTGCTGTGGTTCTCGGCC
AATCTGACAGCCAACAACATTGCGCTCGGCTTCCTTGGCCCCATCGCCTACGGGCTCTCATTCACCGACGCGGCGCTCTG
CTGCGTATTCGGCACGATGCTTGGCTGTGCCGGAACCGGCATCATGAGCACCTGGGGTCCCACTTCTGGGCTGCGGACCA
TGGTTCGTTGCACGGTCGTCTATCCGTCTTGTTCTTCTCACAGAGACTGACGAGCGGCTTAGATCTTTGCACGCTACACA
ATGGGCTGGTGGCCAAGCCGGATCTGCGTGCTGCTCAACATTGTCATCATGCTGGGCTACGGCATGATCGACTCTGTGGT
CGGCGGGCAGATCCTGTCAGCAGTGGCGGACAACAACCTCAGTGTCGTGTGCGGCATCATCATCACGGCCGTGATCACCT
GGGTTGTCACAGTGCTAGGCCTCCCTATTTTCCACATTTACGAGCGGTGAGTGGCTGCGATATCCAGCACCTGGAAGCAC
CCGGGAGTATAGTGCTAACAAGCATTCAGATATGCTTGGGCTCCGCAGCTGGCCGTCGTGTTCATCCTCGTCGGCGTGGC
CGGGGCCAATTTCGACACGTCCTATAGCTCATCGGGCAACCGCGAGACGATCAATGCCAACCGGCTCTCGTTCTTGGCGC
TGTGCATGTCGGCCTCGGTGGCGTGGTCTCCGGTCGGCGGCGACTACTATGTCTACTATCCGGCCAAGACATCGATGGTG
CTCACGTTTCTGCTGACGTGGCTGGGTGAGACGCTGTCGACTGCGTTTGTATACCTCGTCGGCTGTGGCCTGGGCTCCGG
CACGTACTCGAATCCAACGTGGGCGGCCAACTATGACATCTCGTCGGGATCGCTGCTCGTGGGCGCGTTCGAGCCACTGG
GCCGGTTTGGCAAGTTCTGCGGTGTCATCCTGGCGCTCGGCGTGATCGCCAACAATGTTCCCGGAACGTACTCTGCGGCT
TTGGGGTTCCAGTGCCTGGGCAGCTGGCCGGCACGCGTGCCACGGTTTGCGTGGAACACATTTGGCGTCATCATCTACAC
CATTTGCGCGGCTGTGGGGCGCAATCACCTGTACGACATCTTTGAGGACTTTTTGGCCCTCATGGGCTACTGGGTCACCA
TCTGGATCACCCTCACGCTCGAGGACACGCTCCTCTTTCGCCGCGGCTGGACCAACTTTGAGTGGGACGACTGGAACACA
CAGAGCAAGCTGCCCGTCGGCCTCGCTGCTTTGGCTTCCTTCTGCATTGGCTGGGTCGGCTCCGTTCTTTGCATGGATCA
GGTCTACTTTATCGGGCCGCTGTCGAGAAAGATCGGTGACTACGGTGCAGACGTAAGTCCCATTGTGTTTTCCTGTCTTC
AACGCTATGCTGACGTAATCCCCCTAGTTGGGCATATTTGCCGGTGTAGGGTTTGCCGGAATTGCCTACCCCATCCTTCG
GGTCCTAGAGTTGCGAGTACTAAAGCGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62