GenePrediction:GLEAN_5074 Details

Name: GLEAN_5074
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1968430..1966864 (- strand)
Length: 1567
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1968430..1968290 (- strand)
Length: 141
Type: CDS
Source: GLEAN
Position: GCSC_97:1968223..1968003 (- strand)
Length: 221
Type: CDS
Source: GLEAN
Position: GCSC_97:1967944..1966864 (- strand)
Length: 1081
>GLEAN_5074 class=GenePrediction position=GCSC_97:1968430..1966864 (- strand)
ATGGCGCTAGTAATACCAGACACGGCTGCGGCCACGATTGCCGCCCAGTACGACGAGGTAGCCGCGTCCTATGCCGCCAG
AAAGACCATACCCATTGAGTTTCGCAAGCAGCAGCTGAGGCAGTTCTGGAAGCTTGCTGACGTAAGCAGTCCTCCCTACC
ATGTTGCAGAAGTTATATCGCCCCACCTGCTTACACGGCAAACCTAGGATCATGAGGAGTACCTGCGCGAATGCCTGTAC
AAGGACCTGGGAAAGCCCAAGGTTGAGGCGCAGGGTACTGAGGTCGGCCTCTTCAAAAATGAGATCTGCTACCTGCTCGA
CAACATGGACAAGTATCTGGCCCCGGAAACGGTCTATGTGCCGCCAGCGTACCAGGGCCTCAACCCGACTATTGTGCGGC
AGCCCAAGGGCGTTGTCCTTGTGATCGGGTACGTGGACGCGGGCGATGACCTGATGGCCTGGCACACAAGCTGACTACCG
ATACAGCGCATGGAACTACCCCTTCTTCCTGACGGCAGCGCCTTTTCTGGGTGCCATCGTAGCGGGCTGCACCGGCCTCA
TGAAGCCGCCCGAGCTGGCCCCATACACGGCGCAGGCGATGGCAGAGCTGGTGCCCAAGTACCTGGACACGTCGTGCTAC
CAGATCGTCAACGGCGCGGCGGCCACGGCCACGGCACTGCTGACGCACCGGTGGAACCACATTTTCTACACGGGAGGCTC
GCGTGTGGGTACCATTGTGGCCATGGCGGCCGTCAAGAACCACACGCCGTACACGCTCGAGATGGGCGGTAAGTGTCCGG
TGATCGTGACGCCGCGAGCCGACATCGCCCTGTCCGCCCGCCGCGTTGCCTGGGGCAAGTTTGCGTGCGCCGGCCAGACT
TGCGTGGCCCCAGACTACGCCCTCGTGCATGAGGATGTGTATGATGCGTTCATCAAGGCCATCTGCGCGTCTGCCCAGAA
CTTCTTCCAGGGCCGGCCCAAGGAAGACGGCCGCATGGGCCGCATCGTCAACACGGCGCACTGGGACCGCATCATGAAGC
AGTTGCGCGCCACCAAGGGCCGCTTCGTGTGCGGTGGTATCGAAAGCGCCGACCGAGACGACCGCTATGTGCCACCCACG
ATCGTGGCTGACGTCACTGTCGAGGACGCGCTGCTGGCCGACGAGATCTTCGGGCCCATCCTGCCGGTTCTCAAGTACAA
GACGCCTGAGGAGGCCTGCCGGACGATCAACAGCATCATGGACGAGCCTCTGGGCCTCTACGTGATGAGCGAAGACCGTG
CCGACATGGACTGGTTCGTCGACCACACCAAGTCTGGCGATGCCGTTCACAACGACACCATGACCCAGATCGCCGTGCCG
CTGCTCCCCTTTGGTGGCGTCGGTGCTAGCGGACTCGGTTCCTACCATGGAAAGGCCAGCGTCGACACCTTTAGTCACCA
GCGAAGCGTCGTGTATGTGCCAAAGGAGGCTGAGGCTGCCATCGAGTGGCGGTATCCGGACGGCGACCAGAAGCTCAAGT
ATGAGGCGGTCAAGGCGTCTGAAGAGAAGCTCCCGACGGGCCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62