GenePrediction:GLEAN_5075 Details

Name: GLEAN_5075
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1962321..1961874 (- strand)
Length: 448
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1962321..1962034 (- strand)
Length: 288
Type: CDS
Source: GLEAN
Position: GCSC_97:1961957..1961874 (- strand)
Length: 84
>GLEAN_5075 class=GenePrediction position=GCSC_97:1962321..1961874 (- strand)
ATGCATCAAGACGCCATGAGCAGCTGCGGGTCTCGCGCGACAGGCCAGGTCATTACCGGCTGGGCCGAGAATGCCGACGA
CTTCAGCATGCAGAACATTGCCGACAGCCACCATTGGATGGCAGTCACCATGATTGAGGATGACGACCTCATGTTTGACA
ATAAGCCACTTTGCACATGGTACGAGGAAGGCCGACGACGATACAGTTCGGGAGACAACGACAACATGGTACTCTCGCCG
AGCAGCTCTGTTGAGGAGGAGGAAGAGCTGCACCGCGGCAGACAACGGGTAAGACATCATTGCAGAGCTATATGGCGCAA
TACCGTAATCGCATTGACCTGCAAACGCGCTGACACCAAAATAGGATCGTCCGCAATACCAGAAGCCGCCAACCAAACAT
CACAAGACTGCAAGCAGCTCCAAGAGCGACGACAAGAGCAAGCATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62