GenePrediction:GLEAN_5078 Details

Name: GLEAN_5078
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1942237..1940880 (- strand)
Length: 1358
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1942237..1941902 (- strand)
Length: 336
Type: CDS
Source: GLEAN
Position: GCSC_97:1941848..1940880 (- strand)
Length: 969
>GLEAN_5078 class=GenePrediction position=GCSC_97:1942237..1940880 (- strand)
ATGGACCCAGAACACACCCCGGTAGAGGATAGTACTGGTAGCAGCAGTCGAGAAGACGGCCAGCCGGTCGGCGATGTCGA
AAAAGCAGCAGTCGGATTCGAACCGGCACCAGATGGTGGTCTCTTAGCCTGGTCAGTGGCCGCGGGTGGTTTCTTTGTAG
TCTTTTCGACACTGGGCTTCGCCAACTCGTTTGGTGTGTTTGAGGAGTTTTATATGACGCACCAGCTCGCCGAAAAGAGC
GCCGACACGATCTCGTGGATCGGCAGCTGCAGCACGTTCTTCCAGTATCTGGCCGGGGCCGTGTCGGGGCCGCTCTTCGA
TCGATATGGGGCCATGGTGAGTCAATTTTCTCGTCCATCTTCTTGATCTTACTCCTCTGACAGGCTTAGGTTCTCCACTT
GTCAGCCTTCTGCTGCGTGTTTGCTGTCATGATGATCAGCCTCTGCAAGCAGTACTACCAGTTTTTCCTAGCCCAGGGCG
TGCTGCTAGGCCTCGCGAGCGGCGGGATGCAGTTTCCGGCCATGGCTGCGGCGATGCAGTATTTTGACCGGAAGCGCGGG
GCGGCACTGGGAATCATTATCGCGGGCTCGTCGTTGGGCGGCGTGGTGTTTCCGGTGGCGCTGAGTCGCATGCTCAACAC
GCCGGCCGAGGAGGCGCGGCTGGGTTTTGGCTGGGCCGTGCGCATCATCGGCTTCATCATGCTGGGCTCGCTGGTGGTGT
CGTGTCTGACGGTGCGACCCCGACTGCCGCCGCGGAAGACGAGCTTCTTTCTCGTGGGGGCGTGGCGCCAAAACGACTTC
CGCCTGCTCGTGGCCTCGTTCTTCTCCTTCCTCGGCATGATGATGCCGCTCTTCTACCTGCCGTCGTTTGCGGTCTCGAT
CGGGACCCACGCCACACTGGCGTCGTATCTGCTCGCCATCGTCAACGGCGCGTCCACGTTTGGTCGCATCATCCCCGGCA
TCTTGGCCGACCGGCTCGGCCGCATCAACGTCTTGGTCGTCGGCTGCACCACTACCGGCATCTGCATCTTCTGCATGACC
ACGATCACATCCAATGCCGGCCTCGTCGTCTTCGCCATCTTCTTCGGATTCACGTCCGGCACCATCATCTCCGGCATTTC
GGTCGCCCTCTCCATCTGTGTCGCCGACCCCCGCAACATGGGCACGTACATGGGCATGGGCATGGGCCTGTCATCCATCG
CCGCGCTGGTCGGCCCGCCCATCAACGGCCGTCTGGTCCACGCCTACGGCGGCTATCTGCAGACATCCATCTTCAGCGGC
GTCACCTGTCTGGTCGGTGCGGCCCTGGCCTTCTTGGCCAAGGCCGGAACGCCCGCCGGACTGTGGGGGAGAACGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62