GenePrediction:GLEAN_5079 Details

Name: GLEAN_5079
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1930934..1929274 (- strand)
Length: 1661
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1930934..1930775 (- strand)
Length: 160
Type: CDS
Source: GLEAN
Position: GCSC_97:1930712..1929274 (- strand)
Length: 1439
>GLEAN_5079 class=GenePrediction position=GCSC_97:1930934..1929274 (- strand)
ATGGCGGCCAGCTACTGGGACTCGACACAGCGGCGGTTCTGGGAGTTCAGCAAGGAGCAGCTGGCGGCGCGGCGGCGGCA
GCGGCAGGAGGAGGAACGCAGCCTGGTGCAGATGTGTCCGCTGCCGGAGCAGCGATACCTGAACATGTTTTTCTTCCAGC
GTGAGTTCTCACCCGCCTGTGACTTCTTCTGTTTCTCCTTTCCCTCCCGCTGACCCCTGCAGAGCTTAACCGGCTGGGAA
AGCGGACGAACGTGCGACAGCAGGCCCTAGCGACGGCACAGGTGTACCTCAAGCGGTTCTACCTGCAGGTGGAGCTGCGA
CGGACGAATCCATACCTGGTCATGGCGACGGCGCTGTACCTCGCCTGCAAGACGGAGGAGTGTCCACAGCACATCCGACA
GGTCTCGCAGGAGGCCAAGGGTCTGTGGCCGGACGTGGGTGCGCACTGCCTCGAGATCACGCGCATCGGCGAGTGCGAGT
TCTACCTGATCTCCGAGCTGCGCTCGCAGCTCATCGTCCACGCCCCCTATCGCACCCTGCTGTCGCTGCAGGGCGAGCTG
GGCCTGCATCCGGACGAGCTGGCCCATGCCTGGAACGTGGTGAACGACCACTACATGACCGACCTGCCGCTGCTGTACCC
GCCTCACGTCATTGCCGTCACCGCCCTGTTGTGGGCTCTGGTGCTGCCACCGGGAGGAGGAGCCGGAGGGGGCGGTGGCG
GCGCTGGAGGAGGGGGAGGTGTGGGAGGCGGTGCAGGGGCTGGAGGTGCAGGTGCGGGAGGTGTAGCGGGCGGAGGAGGC
GCCGGTGGTCCAGGTGCTGCCGGCGCAGGAGCCAACGCGGGCGTTGGTGGAGCTGTTGGCGGCAACGTCGGCGGCATGAC
GCCCGGTGGCGGCGGTGGCCTCCACGGACCCTCATCTCTTCCGGCGCCGCCCCAACTGCACACGTCCTACTCGTCGCTGT
CGACGCTCGGCGGACCCGGTGCCACCAATACGCCCGGTGGCAGCAACACGCCGGGCGGCGGTAGCGGCGGCAGCATGTTG
CCGAGCACGCCCGGCATGGGCGTCGGTACCCCGAATATGCCCGGCGGTGTTGCGGCCGCTCTGGTCCAGGCACAGGCTCG
CGCAGCCGCCGTGGCGGCATCCCAACAAAACGCTGCTGGTGGTGGCGGTGGCGGCGGCACGCCCAACATGGGCAGCAGTA
TGGTGGCGCTAGGTGCGCTCGGCAGCATCAACAGCATGGCGGCCACCATGGGCACTATGGCGGGCATGGGCATGGGCAGC
ATGAACTTGGGTGGCATGAACATGGCCGGCATGAACAGCATGGTCGGTGGTGGTGGCTTGAGCATGAACGCTGCCGGCGG
GGCAGCAGCAGCAGCAGCAGCGGCGGCTGCGGCAAATGGCAGCCAGCAGGTCGTCCAACAAGGTGGCCAACAGGTCGGCT
CCGCTGCAGCTGGCGACGATAGCAGCCCGCAGGACGGTGGAAGGGGCGCTATGCTGCAGTGGCTCATCAAGTGGCTGGCC
GACAGCGGGCTCGACATGGAGGCAATCATCGACTGCACCCAGGAGCTCATCTCGTTCTACGTCTGCAGCGATGAGTACAA
CGAGAAGCTGACGCGGGAGCAGATCAACCGCTTCATCAAGGTCCGAGGCCTGGATCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62