GenePrediction:GLEAN_507 Details

Name: GLEAN_507
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:239895..240624 (+ strand)
Length: 730
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:239895..239963 (+ strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_97:240022..240444 (+ strand)
Length: 423
Type: CDS
Source: GLEAN
Position: GCSC_97:240502..240624 (+ strand)
Length: 123
>GLEAN_507 class=GenePrediction position=GCSC_97:239895..240624 (+ strand)
ATGGCTTTTCTCATCCTCGTCATCGGCGACCTGCATATTCCAGACCGTGCTCTGGATATTCCGCCCAAGGTTTGTCGTCT
CTCGTTCTCCGTACGCGGCTCTCGGCCCTCGCTCACGCCCGAACCAGTTCAAGAAGCTGCTGGCTCCCGGCAAGATCGGC
CAGACGCTCTGTCTGGGTAACCTGACGGACAAGCGCACGTACGAGTACCTGCGCGCGATCACGCCTGATCTCAAGATCGT
CAAGGGCCGCTTCGACGTCGAGGCCACGGCCCTGCCGCTAGCCCAAGTCGTCACCCATGGTGCCATGCGGATCGGCTTTC
TCGAGGGCTACACGCTCGTCAGCAACGAGCCGGATCTGCTGCTGGCTGAAGCTAACCGGCTCGACGTCGACGTCCTCTGC
TGGGGCGGCACCCACAAGTTTGAGTGCTTCGAGTACATGGACAAGTTCTTCATCAATCCCGGCAGCGCCACCGGCGCCTC
CTTCTTTGGCTGGGGTGGCGACAGCACCAAGGAAGAGGACGAGATCGTGCCCAGTTTCTGCCTCATGGATGTACGTCTCC
TCCACGTTGCCTCCCGTGCGTTTCTGCCCCTGCTGACTCCTTCCCAGGTCCAAGGAATCTCCCTCACGCTGTACGTCTAC
CAGCTCCGCAAGGACGCTGCCGGCGTCGAAAACGTCGCTGTCGAAAAGGTGACGTACACAAAGCCGGTCGAGCCTATCGG
TCCGGCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62