GenePrediction:GLEAN_5080 Details

Name: GLEAN_5080
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1923298..1920731 (- strand)
Length: 2568
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1923298..1923277 (- strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_97:1923188..1923105 (- strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_97:1923027..1920731 (- strand)
Length: 2297
>GLEAN_5080 class=GenePrediction position=GCSC_97:1923298..1920731 (- strand)
ATGTCACTGTGGTTTTTCTATGGTATGACACGATGGGGGACTATTTCGCAATCAAAACCTGTACGGCAAAGAGGCAGGAT
GCCCCGTCCATGTGTCGCCGTACTGTGCAGAGCGGCCATACCTGGAGATAGCCGTCCCAGACGATGCCCAGGAGGTGCTT
TCTGTCCGGTTCATTGTCACCGCGCACGATCAAGGTAAGATACGATACGACCAAAGCGTCGGTGCGGCTCGGGGCAGCCT
GTTCTGACCTTTCACCCGGCTCTTTCTGCAGGCTTCAGCGGGACTTCGGGCGACGTGCCGCCGTACGAGATGTCCTTTAC
CTGGTTCTCGGTGTACGCCGATCGGGTCAACGGGCACAAGGACCCGAGACGGCTCAAGGTGCAGAGCAACTACCGGGCCT
CAGCAGCCTTTCGCACACACGACATTGTGTGGGACGGCAGCGATGCGGACGACGCCAAGACGCGGTGGCTGGCGTCGCTG
CGCGGTGGCGACCGGCTGCAGCTGTATCCGCGGGCCTTTTACCGGGCGTGGGTCAACCTGGTCGCGGGGGCCGAGATGGT
GGTGACGTACGTGCCCTGCGACGTGGAGGAGCGGCTGCATGCACAGGCCCGACGGCTGCTGTATGCGGGAGGCAGCCGGC
CAGCGAAGCTGGCGTATGTCAGTCTGAGCCTGGACCGGCGCGAGATCCGGCTGCTCGAGGTGCTCCCGGGGGCCTACGAC
GAGGCCATCCGGTGCCGGCTGGCAACGGCAGAGCTCGCGAGCGACAGCAGCGCGGCAGGACCGCAGTTTGAGGCGCTGTC
GTACTGTTGGGGGGAGGCGATAGCCGAGGAGGGCACGGAGGTGGCGATCGTGGAGATGCAGGGACAGAGACGGCCAGAGC
AGCAGTTTCTGCGGGTGTCGCGGTCGGTCGAGCTGGCGATCCGGCGGCTGCGCCACGACGACGGCCAGACGAAGCGAGTG
CTCTGGATCGACTCGGTGTGCATCAACCAGGCCGACCTGGAAGAACGGGCGCACCAGGTGCAGATCATGCACGACATCTA
CGGGGCGGCGGCGCAGGTCAACGTATGGCTGGGCGAGGGCGACGGGCGGGCGTGCATGGCGATGCGGATTCTGCGGGACA
TTTACAAAGAGGTCAAGAAGTGCGGTGGCGACGACTTGTTCCGACGGATGCACCTGATCTTTGACGAGCACGCGCGGGCG
CTCGAGACAGCCAGCGGCACGCACACCGAGTCGCTCTATCACGCGATGGCAGCGCTCTTTGGCAACTCCTGGTTCCGGCG
CGTCTGGGTCTTCCAGGAGGCGCTGGCCGGTCAGGTCACAGTGGTGCACTGCGGGCGGGAGTCGATCCGGTGGTCGGAGC
TGGTGGCCGTGCATGCGCTCTTCAACCGGGGCGACAACTTTCTGTCGCCGCTGCACAGCGCACCGCAGGCTTTGATGCCG
CCGTTGTGGGAGGTGTTGGGGAGCGAAAGCGAGAACAGAAAGAAGACGACGAGCGTGAGCGAGGACAAAAAACCCCTCTT
CGACATCCTCCTCTCCGGCATCGAGGTCGAGGCCACCGACCCGCGCGACAAGATGTTTGCCCTGCTCGCCTTTGGCCGTG
AGACCGGCCAGCGCATGCGCCGCCTGCCGCTGGCTATCCGGCCTGACTACACCAAGCCGGTCGAGCAGGTGTTTGCCGAC
CTGACGCGCTGGCTTCTGCTCGAGCAGCGCTCGCTCGACGTCCTCTCGGCCGTCCACGCCCAGCCCGGCCGCACCTGGCA
GGCCCTGCACTGCTCGTCGCTGGCCGCACCCCCATCGCCGGCTCGACCGACCTGGACCCTCTGCCCCGACGGCAGCAAGC
ACTGGATCCATGCCACGCTCCTGGCGCAGTTGGACTTTGCCGCCGCCTCCACGGCTGCCTGCCCGCTCGACCTCGCCCTG
CTCGACGCGTCTGCGCAGGCTGACCCGCTGCTGCTCCGTCTTCGCGGCTTCCGCGTCAGCATCGTCACCCAGATCACCGC
CTTTCCCTTCGACCAGGTCCAGCAGCGATGCGTCGAGGAGAAGGAGAGCAACGACCACTACTGGGCCGATCTCCTCCACG
CCTTTGCCGCCATCTTCGATCCCGGCTGCGTCGTCAAGTCCTGGGTCAGCTCCCGCGTCGATGCCCACACCGAAAAGGGC
TCCTTCCGCCACGCTGAACCGAACGCTGTCATCGCCGAACACTTGTACGCCCACTGGGGCTACGGCCCCGTGCCGCCCAA
CAAGGCCGCCAACCTCGACCGCTGGGAGCCGCCCCGCTACCGCCTCGTCGACAGCACTGCCGTTCCGCCCTGCGTCAGCC
GCTGCCTCATGGTCCTCTCCGATGGCGCTGTCGGCCTCTGTCCCAGCACTGCTCGCGAGGGCGACATCGTTGCCGTCCTC
TACGGTGGAAAGGTGCCCTTCCTCTTGCGTCCTTCGCTGTCCACCGCATCCACACAGCCCACCGTGGAGCTGGTCGGAGA
GTGCCTTCTGCGGGGAGTCATGCACGGCGAGTTTGTCGGCTCCCAGATGCGAAACGGCTGTGCGCCAGAGGTTTTCTCCA
TTGTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62