GenePrediction:GLEAN_5082 Details

Name: GLEAN_5082
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1914666..1913533 (- strand)
Length: 1134
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1914666..1913533 (- strand)
Length: 1134
>GLEAN_5082 class=GenePrediction position=GCSC_97:1914666..1913533 (- strand)
ATGCGGCTAACACGGCCAGCGAGCCTCTACCGGCAGCAGGCTCTCGCCTTCCGTCGACCGTATGCAGGAGTCCGGACGCT
GGATCGAATCCATACGACGGCCATGGCCCGGGTGGTAGCTTCTCCGACGGTCTCTGCGAGCACTGGCACAGACGATCGGC
CGACGGCACCATCACTGCCGCCATACACACGCCCGACTTCAGGCCTCCTCTCAGTGCTTCCGGCGTCCTGGGTTCCATAC
GCAGAGCTGACACGCATCGACAAGCCGACGGGAACGTACTACCTCTTCTTTCCCTGCCTCTTCTCGACGCTGATGGCGGC
ACCCATGGTACAGCCGGCTATGGCGACGCCCGGGGCCGTGGCCGGCACGTCGCTGCTCTTCTTTGCGGGCGCCCTGATCA
TGCGCAGTGCCGGCTGCAGCATCAATGACCTCTGGGACCGCAACCTAGACCCGATGGTGGCGCGCACGCGACACCGGCCG
CTCGCCCGCCAGGCTATCACGCCCTTCCGCGGTCTCGCCTTTACGGGGGCGCAGCTGCTGGCTGGCCTCGGCATCTTGGT
GCAGTTTCCGACGTCGTGCCTTTACTACGGCATTCCTAGCCTCGCGCTCGTGGCCACGTACCCGCTGATGAAGCGCGTCA
CGTACTACCCACAGTTCGTGCTCGGCCTGACCTTCTCGTGGGGCGCTATCATGGGCTTCCCGGCGCTCGGCGTCGACCTG
CTCGCAAACAACAGCGCTCTGCTGGCCGCTGGCCTGCTGTACTCGTCCAACGTCGCTTGGACGGTGCTCTACGACATGAT
CTACGCCCACATGGACATCAAGGACGACGCCAAGGCCGGCATCAAGAGCATCGCCCTCAAGCACGACGCCCAGACCAAGT
CCGTGCTGACCGGACTGGCCGTCGTGCAGGTCGGCCTCCTGGCTGCTGCAGGCATAGCTTCGGGCGCTGGTCCGGCCTTT
TTCGTCGGCAGCTGTGGCGGCGCACTCGTTTCGCTGGGCGTCATGATCCGTCGCGTCAACCTCAAGAGCGTCAAGGACTG
CTGGTGGTGGTTTGTCAATGGCTGCTGGCTGACGGGCGGTGTCATCGGCATCGGTCTCGGCGCTGACTATCTGGTACAGT
ACGCTGGCCGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62