GenePrediction:GLEAN_5085 Details

Name: GLEAN_5085
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1908755..1905398 (- strand)
Length: 3358
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1908755..1906494 (- strand)
Length: 2262
Type: CDS
Source: GLEAN
Position: GCSC_97:1905958..1905398 (- strand)
Length: 561
>GLEAN_5085 class=GenePrediction position=GCSC_97:1908755..1905398 (- strand)
ATGCATCAACAACAGCAGCCGATTGGGCGGGCGGGCCAAGCCGCCCTCTTGACGTGGGTCAACACATTTGCTCTCGACCG
CAAGGTGGAGCGGCTAGAGGAGCTGGCGGACGGCCAGGTGTTTGCGCAGATGCTGCACGACCTGGACTCGGAGTACGATC
CGGCCGAGCTGGAGCAGAACACGGGGTCGTCGGCGTGGTTGACGAACAAGCGCAATATCCAGTCGGTGTTCAAGGCGTTG
ACGCGGTACATCATTCACAAGGACCGGAGCGGCGCAATCGAGTTTCTGCCGCGGACGGTAGACTTCCGGGCCATCTCGGA
CAATCTGAACGCCGAGGGACTGGCGCAGCTGGTGGCCGTGTTTGTGGCGACAGCGATGTTGGGCAGCCACAACACGCAGT
ACATCCCGGTGATGCGCAGCAGCCTGACGACGGCCGAGCAGGCGGCGATCATGACGATCCTACAGCGCAAGGCGGAGGAG
CGGCAGCGGCTGGCCGACAGCGGGACCGACGGGGGTTCGCTGGACGAGGCCGAGACGGCGATGCTGGGCACGGGCTCGAG
CACGGGCGCGGGCACAGACGCGGCGCTGGTGGCAGAGGAGCGGCTGGCGACACTGGCGGCAGACTACGATCGGCTCAGCA
AGCGGCTGGCTGACACGAGCACGCGGCTGGAGCACCTGCAGATGTCATACGAGGCCATCAAGGAGGAGCTGGAGCGCAAG
GAGAAGGAGCTGGACATGGAGCGACAGAGCCACGGGGCGACAGAGTCGCAGCTGGTGCGGGAGCTGCAGGAGAAGCTGCG
CGAGCAGGACGAGCTGATCAGCAGCCAGGAGGCGCAGGCGGAGGAGGACCGAGCGACCAAGCAGCGGCTGGCACAGGAGA
GCGCGCAGCTGAAGCGACAGGCGGCACTGGTGGAGCCGCTGCAGGACCAGGTGCAGGAGCTGCGACACGCCAACGACGAG
CTCAGCAAGAAGGCCAACACGGTAGACCGATACAAGCAGAAGCTGGAGACGCAGCGCGGGCTGGAGACAGACCTGCAGAA
CGCACTCTACGAGCTGGGACAGAACAAGGAGGCGCTGAAGGAGCTGGAGGCGCTGCAGCGACGGGGCGGCCAGCAGCAGG
CGACGATCGAGCGGTTCCGTGAGATGGTGTCAGGGCTGGAGCAGCAGATCGAAGACAACCGACTGCAGCGAGCGGCGCTG
GAGAGCGACGTATACGGAGCCCACGTGCAGCTGGAGAGTCTGCGCGACCAGAGCCAGCTGAGCGAGGCGCGCATCGCCGA
GCTGGAGCAGCAGCTGCTAGTGCACGGCATCGTGCTGGTGGGCAGCGGCAGCGGAGCGGCCAACGAGAGGGAGAATGGAG
CCGGAGCCGGAGGAGGAGCTCCAGGCAGCGTTGCGGGCAGTGCAGGTGGCAACATCGAGGCAGCAGGAGGCAGCAGCGTG
GCAGCCAAGACGTTCAGCCTGGAGGACGAGCTGCAGCACGAGCATGAGCAACAACAGCAGGAACAGAAACAACAGCAGAC
GGTCGAGCCGACAGCACAGGCACTAGAGCTGGCACGGCTGCGGGCAGAGAACAGTCTGCTCCGAGGACGGCTCGAGTCGG
GCACAGAAGGGGACCACCGGCTGCGGAACGAGCTGGAAGCGACGCGGGCCAAGGAGGAGTCGGCGCGGCAGCAGTACAGC
GCGCTGCTGGAGAAGCACACGGTGGCCGAGGCGCAGGTGCAGGCGCTGCTAGGAGGACGAGCCGGCGAGGGGAGTGCCGT
GCTGGCAGAGGCGCGACAGCGGCTACAGGCGGCAGAAGGCGAGCACGAGCAGCAGACGGCGGCGGCAGTGGCGCTGGAGC
GACAGGTGGCCGACAGCCAGCGCGAGCTGTTGCGGCTGCGCGGCGACCTGGCCGCGGTCGAGAAGGGGTCGGTGGCCGAG
GCGCTGGCCGAGCTGCAGGCAACCGATCGGCTGGTGTCGGAGTCGCTGAGCCAGGAGGTGGCGTCGTTGCGGCGCGAGGT
GCGCGGGCTGCAGCTGGACAAGGAGCAGCAGCAGCAGCTGCTGGTCGAGGCGCTGCTGTCCAAGGGTGGCATGGCCAAGC
GGGAGGCCGAGATGGCGGCCGAATCAGACTCGACTGCCGAAGCAGAGGCAAAAAATGGGACGACGGCCGGCCAGCCGGAC
AAGGCGCACACAACAGCAGACTCTGCCGCGACAGAGGAGCAGCTGCGCCGGGTCGGCGAAAAGAACGAGAAGCTGCGGGC
GGCCGTGAAGCAGCTGAAGAAGGTTGGTGCGCTGCTGTTTCTGTCTTTGTTTTCTGTTTCTTCTTTTCTTCTTTCTTTCT
TTTCTTTCTTTCTTTCTTTCTTTTCTTTTTTTCTTTCTTTCTTTTCTTTAGTTTCTTCCTTCTTTTTTCGTTTCCTTCCT
TCTTTCCGTGATTAGTCATCACATTACTAATACCCTCCCAGCAGTACGACGCGACCGAGCTGGAGCGACAGGAACTGCAG
CGGCGGGTGCGGGCGGCCGAGGCGACACCGGGCAGCGCGGCAGCGGCAGCAGCGATGGCGGCCCAGCGTGCGGCGTCCGA
CCAGGTGTTGCGCAGCCTACAGCGCGAGAACGCCATGATCGCGACGGCGTGGTACGATCTGACGAGCCGGCTGCAGAGCA
ACCACGTGGTGTTGCAGCGGCGGCAGGACGTGCCCAAGAGCTGGCTGAACAAGCAGCGGCAGATGGTGAATGCCACGCCG
CGGAAGTAGGAGGGATGGCATCAACAGCAGCAGTTCGTCGTGGTCGTCTCGGCCGTCCGTCTGGTCGTCGAACGCAGTCG
CTGGCGCGACCGCAATCGCTGGCGCGCATGGGTCGACCGACCGACCGTCGGGGTCCCTCGCTCGGTCCGCCGGCCGTGCT
GGCCGTTCGTGGCCGCTCTACCGGTGGTGGCAACAGCAACAGCCACAGCAACAGCACCAATCTCGTCATCTTCAGCTCAA
CTTCGGCACGCGGTCGTGTCGATCGTGCTGACCGGCGCCGTGCTGCTCGGCTTCGCTTCCGCGTCGGCGTCATCCAGGGC
CTCCGTGCTGACATCCGTGCCGATATCCAGGCCGGCATCGTGGCCGGTTTCCGCGCCGTCGTCACTACACGCCAATCTCC
CGTCTCGACCGCCGTCGCTACCGCCCTCCTCGTCGCTGCTGCTGCCGCGCTCTTCGCCATCGTCACCCCCTTCGCCTGCG
CCCTGCTCTTCGTCTGTCTCGGCCTCTCGGCTGCCCTGTTCTCGCCCCTGCTCTGCGCTGCCGCCTACTACCGATATACC
CTTCTTGGTCGACGCGGACCGCTTGTTAGCCATGAACGTGATCCCTTGCTTCGCGGTCACATGACGTCGGTCACATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62