GenePrediction:GLEAN_5086 Details

Name: GLEAN_5086
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1890029..1885596 (- strand)
Length: 4434
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1890029..1889953 (- strand)
Length: 77
Type: CDS
Source: GLEAN
Position: GCSC_97:1889849..1889821 (- strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_97:1889744..1889719 (- strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_97:1889653..1889617 (- strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_97:1889526..1889453 (- strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_97:1889390..1889197 (- strand)
Length: 194
Type: CDS
Source: GLEAN
Position: GCSC_97:1889129..1888892 (- strand)
Length: 238
Type: CDS
Source: GLEAN
Position: GCSC_97:1888675..1888625 (- strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_97:1888565..1888548 (- strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_97:1888483..1888322 (- strand)
Length: 162
Type: CDS
Source: GLEAN
Position: GCSC_97:1887118..1886031 (- strand)
Length: 1088
Type: CDS
Source: GLEAN
Position: GCSC_97:1885958..1885878 (- strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_97:1885824..1885596 (- strand)
Length: 229
>GLEAN_5086 class=GenePrediction position=GCSC_97:1890029..1885596 (- strand)
ATGCTCGACGCAACAAATGAGATCAAGCTCCTCACGGGCTCCAGCCACCCAACGCTGGGTCGGTTGATTGCTGAACGGTA
GGTGCTCGATCCGGAAGCCTGGATTGCAATGCTTTAATGCAACTCTACAAGTCATGCTATGCTCCAGCTTGCTCGGAAGC
TAATGAGTTTCGATCCACAGTCTCGACATTGAGATCGCCAAGACGATGAGTGCGTTGGCCTTCAGGCTCTCACTCCCCGA
CATGATAATAGACAAGTGGATGACTAACGGCGTTTTGCTCTGCAGGCATCAATGATTCAAATCAAGAAACTGTAAGCCCG
ATACGCACGCTTATCTTAATGTCCTTTTATGTTCTATGTGCCTGACCGATCCCTAGAGCGTGACCATTGGCGAGTCCGTG
AGAGATGAGGATGGTAAGAAAGCAGACGAAGAATGGACATTGCCAAACTCTTACCGCCTACGTATTCACTACGTCATCTG
CCCCTGCTAATGCCTGCCTTCAGTGTTCATCCTGCAGTCCACAGCTCCGGGTGACATCAACAACGGGCTGATGGAGCTCC
TGGTCATGATCCATGCTGTAGGTAGCCCGTACGTCCAGGGAGAAACATCCTGCAACGCAATACTTACCATGATGCTCAGT
GCCGGACCGCATCTGCCCGGCGGATCACCGCTGTTGTGCCCAACTACCCCTACGCTCGTCAGGACAAGAAGGACCGCAGT
CGTGCACCCATCTCGGCGAAGCTGGTTGCCGACATGTTGGTCCAGGCTGGCTGCAACCATGTGATCACGATGGACCTCCA
TGCCTCGCAGATTCAGGGTTTCTTTAACATCCCGTAAGTCAATGGATGCAGAATTAGCGGAGACGAGCCCACAATCTCTT
TTCGGGCGCTGACTGTGTAGGGTCGACAATCTGCTTGCGGAGCCGAGCGTTCTGCGGTTCATTCGCGAACACCTTCCCCT
GCAGGACACTGCGATTGTGAGCCCTGACGCGGGCGGCACCAAGCGCGTGACGGCAATTGCAGACCGTCTTGACCGGCCAT
TCGCCCTGATCCACAAGGAACGGCCACAGCCGGGAGTCGTGGGCCGCATGATTCTGGTGGGCGACGTTCGGGATAAAGTG
GCCATCATTATTGACGATGTGAGTTGAGACATCGACCTCTTTAGAGACTGTCGCTAACAGTTGAAGATGGCCGATACCTG
TATGTCCGAGTTCGGCGATTAACCGGTATATCCTCTCTACTTGCATAGAACAGCGCTGACAGCAGGTTGTCTTACTAGGC
GGTACGCTCGCAAAGGTAAGAAGCCTTCCTGACTTCGCTAGTTTCAATGTGCGTGTATTCTAACAGTAATCCAGGCAGCG
CAAACAGTCATGGACCACGGTGCACGAGAGGTGGTTGCCATTGTGGTAAGTTTCTTGCCCCTCGTTGATCACCTATCTGA
ACGAGAAACTGACAGTACGGACAGACCCACGGTATTCTCAGTGTAGGTTGATGCGCTCACTGGACAGAGGACAGACAACA
CGATGCGAGTACTGACTATTATACAGGGCAAGGCTGTGCAGACCATCAACGAGAGCTGTCTGTCGCAGCTGATCGTGACG
AACACGGTCCCTCTGGGCGACAAGCTCGAGCGATGCCCCAAGATCCGCATCATCGACGTCAGTGCCACAATTGCAGAGTC
GATCCGGCGGACACACCACGGCGAGAGCGTCAGTTCTCTGTTCAGGAACGTCCCTCTTTGAGAGGACAGTCCGGCTGCTA
TTTGTTTCGCAGGGCTGGTACGGGACGGGTGCAGGCCCTTTGTCGAGCTGGGCCGAGGTGGTTATTCTCTCGGGAATAGA
TACTTTTTGCGTTGGGACCGAAGAAGGAAATTAGCTTTTGATCTTTAGAATTCGTGCTTTCGCATTTGCTTATTTGGTTC
AATACTGCGCGTCGCTACACCAGCAATAGAGACAGAGAATACCATCCATGTAGAAATACGTGGATCTTTTGGATTATCAA
AGGCGTTCTTGTTGTAATCACATAATATGAAATCAATCAATTCAAAGTAAGCTTCCCTTCAACATTCGTCATTCTAAGCA
GGTCTTCGTGGTCGAAGTTTGCATGGTCGCGTCTTCTTGAGGAAGGGTCCATGATGCTTAACCAGCTTTACTGTTGTCAA
TCAGCCGGGTTACAGGAGCTTTTTGTCGGTTATCCTATCGTCGGAGCCCCCGTGCCAATGTTCCTAGTGGCTTGGTATTG
TCACAGATGCCCATTTCGCGTGGAGTGCCAAGGCTGGAAAGCGAAGCCTGTTTCTTGGCAAAGACAGGTAGACTAAAGTT
ATCGTGAGCTTCTTAGGAAAACGTGTCGGCGGTGGCACAGTTATGGGGTTGCTCTAGTCACATCAAATTATATAGGCCCA
CTCAACGTGCCTCTTTTCTTATCATTGGAATGTAGCAACTTTATTCATGCTGAGACCGTGATAGTCGGCTTTGGGTCGAT
TCTTCCCTGTAAGAATTATGGGTGTCGGCCGGCCCGAAAAGCTGCTGCTTTATCATAGAGCCATCTGTGAGATCTCTTGG
CTGAAGTGTAGCTTCCTAGCTGTCGGGTGGACTATGATAGATTATCAGACTATCGGGGTTGAAAGATAGTTAACGGGGAC
GACATATAAGTCCATTCGACAGCCTCTGAAGTTGTTGCGATCAGCAATGAGAGCACGGTTTATGGAACCGAGTACGACGC
TATTTCTTCAATTCATCCGCCTGTTTCAAGATGGCGCCACTCAGCAGGCCATTGTTGCTTGTTTGCGTTGTGGCAGCTCT
CAACTGCGCCTGTGTTGGTTATGATTCGAGCATGATGTCCTCGCTAAACATTCTGGTACATTTATCTACTCTGTTGGCGC
TCAGATAGTTCATGCTAACTTTGTGTGAAAGACCTCATTCCAACGACACTTTGGTATTGATGCAAACATCAAGGGTCTCT
TGACTGCCTCAGCCAATATTGGAGGAATCCTCGGCGGCCTCTTCTCTGGTCACGTCGTCGACAAATGGGGCCGGAAAATG
GGCATTTTGATTTCGGCACTGATAGTACTGGTCTCTTGCATCCTCCATTCGACGTCAACCACTCTGGGACAGTTCTTTGT
AGCCCGGATCCTTGTCGGGTTTGCAAAAGCGATGGACATTGCCTCTGTGCCTACCTACCTGGTAGAGCTAGCACCTCCAG
CTCATCGCGGCTTTGTAGCAGGCCTTTACTGGGCATGCTGGCTTCTGGGAGCCATCATCTCCTCGGGCGTTGGATACGGT
GCCAGAAGCGTGGCAGGACAATGGAGTTGGCGAATCATCTGCATCTGTATGGCTGGCCCCGCGCTGTCCTGCATTGCTCT
CCTCCCGTTCGTTCCAGAGTCTCCGCGCTGGCTGATGTCTCGTGGCCAAGACGAACAAGCGCTCAAAGTGCTGGCTAGAT
TCCACGGTGGTGGAGATGAAGAGCATCCATTGGTCGTTTCCCAATTCCGAGAAATCAAGGAGGCAATCTCCTATGAACAG
GACAACAAGTTCGAGACGTTTATAGCCTGGTGGAAGGCCTTCACGGCACAAAAGTCGAACCTTTATCGGGGGTACATTAT
CATGACTCTCGGTATCTTCGAACAGACCATCGGCTCCAGCATCATCACGTACTATCTGAGCAGTGTTCTCAGTCTCGCTG
GGATCACCTCTCAGAAGGAGCAATTTGCTATCAGCATTGGCCAAAATTGCGTGGCTTTCGCCTCGGCACTTGTTGGTATT
TGTATCATTGACAAGGTTGGGCGAGTGCCAATGCTGGTTGGTGGCACCGCATTTTGCGCCGCTGTCCTTGCGTGTATGGC
CGGGCTCACGGCAGATCAGACTGACAATGAGAACGGAAGGAATGGCATCATTGCAATGGTCTTCCTCTTCCAAGTCGGCT
ACTCGTCAACGTGGACGCCCTTGTCTTTCTCGTATTGTGCCGAAGTGCTCAATTTCACCATTCGTGCCAGGGGCATGGCG
TAAGTGAATCTTGTCGATGTCCTTTCCGAAAATCACAAGCAATGCAATGGCTAATGGGATATATTGCACAGTTTCTACAA
CATTTTCACTTCTTCCACTGGGTTCTTCAATCAATACGTGATTCCTATCGGACTGGCCAACATCAAGTGGAGGTATGCAC
AATTTCGAAAACTACAAGAAAAATATGCTAATAGACCTTGTGTAGATTTTATCTTGTCGGCATTTGCTGGAACACTCTCG
TTACCGTGGTCATTTTCTTCACGTATCTCGAGACCAAGGGTTTGACTCTCGAGCAGATCGATAAGCGCTTTCAGGGGGTC
CCTAGAGATCAACTCGACAGCATTGTTGAAGTTTACAACGGAGAAAAGCCGATCTTGGAGACGGAAATCGTTTCGAAATC
CGAAAAGGACAAAGACACAAAAATTACTGTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62