GenePrediction:GLEAN_5088 Details

Name: GLEAN_5088
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1872384..1870563 (- strand)
Length: 1822
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1872384..1871946 (- strand)
Length: 439
Type: CDS
Source: GLEAN
Position: GCSC_97:1871887..1870563 (- strand)
Length: 1325
>GLEAN_5088 class=GenePrediction position=GCSC_97:1872384..1870563 (- strand)
ATGTCTACGAGAAAGAACGGCGAGATCCAGTCGCTGGATAACTATGGCGGGCCATGCGATCTGCAGACAGACAGCGGACT
CAGGCTGCATGGTTTCGTGTCGACGCACGGCGTGGCCAACTTCCTCAACGTGCCGTACGCCGTCTTTCCGGCACGGTTTC
GCACGGCGCAGCTGCTGGACCTGACGGTGCTTACGGGCGACCGGGACGCCTCTCACTACGGCCCACGCTGTCCGCAGCCA
GACGACGCGGTGCACATGCTGATGCAGCACCTGTTTGAGAAGCTGCCGATGCCGCAGTACACGGAGGAGTTTTCGTGTCT
GGACGTCAACATCTACGTGCCACCGCAGGCGCTGGCCGGCGGACAAGACGGCGGTCTGCCGGTCTTTGCGTGGATCCACG
GCGGGTCCTTTAACACGGGCGACAACACGACCGAGTTTGGTTTGTCCCTATCTGCATCTGGGAGTCGGAGCATCTGTCTT
CAGCGCTGACTGGCCAGATGGAAACCACCTGGTGGCGCGGTCTATGCGGCTTGGTCAGCCGATCGTGGTAGTGACCATCA
ACTACCGGCTCAATGTGCTGGGCTTCCTGACGTCGGCCGAGCTGGACGCCGAAGCACGGGCAGCCGGCGAGACGCCGGTG
CGCAACCAGGGCCTCAACGACCAGCGGCTGGCGCTGCAGTGGATCCGGCGACACATTGGAAGCTTCGGTGGCGACGGCCG
GCGGGTGACGGTAGCGGGCGAGTCGGCAGGTGCGAGCAGCATCCACTGTCTGCTGAAGAGCCGGCCTCAGTTCGGTGATG
ACGATGATAGAGCGCTGTTTTCGGGTGCGCTGATCTGCTCGGCACCCTTGCCGGTTCTGCGACCGCGCAGCGACGGCCAG
GCGCTCTTTGACCGGCTCGTGGCGGCGGCAGGTGTTCGGACAGACGCACCGGCCCCGACAAAGCTGGCAGTACTGCGGAG
CCGCGAGGCGCAGGAGCTGATCGCGCTGGTGGCGTCGTCGCTGAGCGTGTCGTTTCCGTATGCCGACGAAGCCTGGTTTG
ACGAGGATGCCAGCAGCAGCAACAACGACAACAACAGCACACCCGATACATCCTACTGGGCCCAGCTTCCGACTTGGTGT
CGTCGCGTGGCCGTAGGCCATACGGCTGACGAGGCTGCCCTGTTCTTCTCACAGCACGCGGCGGCGGCGGCGGTGACGGA
GACGCAGGCCCGCCAGTACATCCAGAAGTCTGTCTGTGCGGGCTCGGCCGCCATGGCGGCAGTGATCTGGGACGCGGAAC
CGCTGCAGGATGCGGGCGGCTCGACTGCGCGGCCGCTGCGACGGCTTGTGCGGCTGGCCACCAACGCCATGATGGTGGTG
CCAGCGCGGGCGTTTGTGCAGGCAGTGGCGACCTCTGCTCCCGACACGGACGTGTACATGTACTCGATCGATCTGCCGGA
TCCGTTTCCCGGCCGCGGCCTCGAAGGCGCTTCGCCCGGTCCGCTGCACGGCTTCGCGTGGCACTCGTTTGGCAACGCGC
TCGTCTTCTACCAGCCGGCCTGCCAGGCAGACGCGCAGCTGGCGGCTACGGCCGACCGCGTCAGCGAGGCCGTCGTCGGG
CTCGTGCACGGGATCCGGGCGCCGGGCGGGTGGTTGCCGCTGACGCCTGCCAACGCGCGCAAGATGAGCTGGAAGGGCAG
TGACAGCGGTATGGTGGCGGCTGGCCCGGTTGGCGACGGCGTGGCGGCGGCGCTGCAGGCGGCAGGACCAAACGCGGCGT
GGGACTCGGCATATGCAGCCTTTTGCGTGGATCCTGTCCGGATCATGGGGCTGATGAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62