GenePrediction:GLEAN_5089 Details

Name: GLEAN_5089
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1869737..1867827 (- strand)
Length: 1911
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1869737..1869726 (- strand)
Length: 12
Type: CDS
Source: GLEAN
Position: GCSC_97:1869665..1869607 (- strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_97:1869537..1869206 (- strand)
Length: 332
Type: CDS
Source: GLEAN
Position: GCSC_97:1869138..1868635 (- strand)
Length: 504
Type: CDS
Source: GLEAN
Position: GCSC_97:1868585..1868152 (- strand)
Length: 434
Type: CDS
Source: GLEAN
Position: GCSC_97:1867835..1867827 (- strand)
Length: 9
>GLEAN_5089 class=GenePrediction position=GCSC_97:1869737..1867827 (- strand)
ATGAAGGGCGAGGTGAGCGATTCTGGCCAGGGCTCTCAATGCAGTCCATTGGTGCAGTACTGACCAGTTTAGATTCTCCA
TCTTCACCTGGGCCAGGCTGGAACGCAGCTTGGCAACAGTGCCTGGGAGCTGTGAGCTTGACTTTCTTTCGCGTCTTGGT
TCTTTTCTTCTTCATTCCATTCCTCGTATTGACTTCCAAGCTACCTCCTTGAACATGGTCTCGGCGCGGATGGCCTCAAG
GACCCTAACGCGTCGGCCGACGTTGGCGACGGCGGCTCGTACGAGACCTTCTTCACCGAGACCAGTGGCGGGCGGTCCAA
CGGCCAGGCAAAGTACGTGCCGCGGTCCCTCTTTGTCGACCTGGACCCGTCGCCGATTGACGAGATCCGCACGGGCCAGT
ACCGCCATCTCTTCCACCCCGAGCTGCTGATCAGTGGCAAGGAGGACGCGGCCAACAACTATGCCCGCGGCCACTACACC
ATTGGCAAGGAGCTGGTCGAGAACGTGATCGACCGGATCCGTCGAGTTGCGGGTGAGCTGCCGGTTGCAGGACTCCAGGC
CGCTGTGCCGACGTGCAGACGCTGACGTGCTGCCCTCAGACAACTGCAACTCGCTCCAGGGCTTCCTCATCTTCCACTCG
TTTGGTGGCGGCACTGGATCCGGGTTCGGGGCGCTGCTGCTGGAGCGGCTCTCGACCGAGTACGGCAAAAAGTGCAAGCT
CGAGTTTGCCGTCTATCCGGCGCCGCGCGTGGCGACGGCGGTGGTGGAGCCGTACAACGCCGTGCTCTCGACGCACAGCA
CGCTCGAGAATGCCGACTGCACGTTCCTGGTCGACAACGAGGCCGTCTACGACATCTGCCGCCGCAACCTCGACATCCCG
CGGCCCGACTACGAGCACCTCAACCGGCTGATCGCCCAGGTGGTCAGCTCCATCACGTCGTCGTTGCGCTTTGACGGCGA
GCTCAACGTCGACCTCAACGAGTTCCAGACGAACCTGGTGCCGTACCCGCGCATCCACTACCCGCTGATCAGCTACGCCC
CGGTCGTGTCGGCCTCCAAGAGCGCCCACGAGAGCTTCAAGGTGCAGGACTTGACGCTGCAGTGTGAGTCGTCTGTGTGT
GCGCTGGGCTTGCTTATGTGCTGACCTCCCAGGCTTCGAACCGAACAACCAGATGGTCGTGTGTGACCCCCGCAACGGCA
AGTACATGGCCGTGGCGCTGCTGTATCGTGGTGACGTGGTGACGCGCGACTGCAACACGGCCGTGGCGGCGCTCAAGGCC
AAGTCGTCCTTCAACCTGGTCGAGTGGTGTCCGACCGGGTTCAAGATCGGCATCAACTGCCAGAAACCGATGGCGGTGCC
GACAGCGTCGCCGGCCGACGGCGGGCTGGCCAGCGTGGATCGGTCGGTGTCGATGCTGTCGAACACGACGGCCATTGCCG
AGGCCTGGTCGCGTCTGGACTACAAGTTCGACCTGATGTACAGCAAGCGCGCATTTGTGCACTGGTACGTGGGTGAGGGC
ATGGAGGAGGGCGAGTTCAGCGAGGCGCGCGAGGATCTGGCCGCGCTGGAGAAGGACTATGAGGAGGTCGCTGGCGACTC
GCTTGAGGAAGAGGAGGGTGAGGCAGAGTACTAGAGAGAGGTGGAGTACTGGGGGGGGAAGAGTGGAAGGAGTGGAAGGA
GTGGAAGGATTGGAAGGAGTGGAAGGAGTGGAAGGAGAGTGGAAGGAGAGTGGAAGGAGAGTGGAAGGAGAGTGGAAAGA
GAGTGGAAGGAGAGTGAAAGGAGAAAGTGAAAGGAGGAGAGAGGCGAGAAGTAAGAGAGTGACGAAGTGGAGTGGAGGAT
AAAGACAGAAGAGTCTCACGCAGCTGATACGTCTTCTGTTTCCTCCAGCTGTCTGGTTATAGCCTCCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62