GenePrediction:GLEAN_508 Details

Name: GLEAN_508
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:243835..244411 (+ strand)
Length: 577
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:243835..244063 (+ strand)
Length: 229
Type: CDS
Source: GLEAN
Position: GCSC_97:244144..244203 (+ strand)
Length: 60
Type: CDS
Source: GLEAN
Position: GCSC_97:244269..244411 (+ strand)
Length: 143
>GLEAN_508 class=GenePrediction position=GCSC_97:243835..244411 (+ strand)
ATGGCCTTCAATCCGCGGGCAATGTCTTCGGGACATTATCGACAAGCCTCTGCGTCCGACAACCTGAACGCTGCAGGGAT
GTCGGCAAGCGTATCGCTGCAGACACGTGTCAACGAGAAGAAGGAGGAGCTCGAGAATCTGAAGCAGTTGCGGGACCTAA
GCGCTGCAGTCGCTTCGCAAATGGAGGCTCTCGAGAACAAGCTCTCGACGCTCTCTGATGGCACAGAAGGTGCGAGGCTG
GATCTTGTGAACAACCGGGGCTATTTTCGTTCTTGCAGCAATTGATGAACTGACTGGCCGGATTTGCAGCGATCGCAGTA
GTCATGGCCAACTGGAACAATGTATTGAGGGCAATCAATATGGCAACGAGTATGTATTGATCTGACTGTGTGTCACCACG
TGCTTATGTTGGTACCGTCGCTCATATGCTGTAGCAAAACTTCCTCGCGCCACCGAGTCCGAGGATACGATTGCACTTCC
ACAAATGCTCGTCCGCATTCCGACCGAACATGCTCCCTCGCTCCAAGCACAAGCAGCCGAGGCTGGGATCATTTCTGACG
AGCAGGAAGGCGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62