GenePrediction:GLEAN_5090 Details

Name: GLEAN_5090
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1864969..1862530 (- strand)
Length: 2440
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1864969..1863639 (- strand)
Length: 1331
Type: CDS
Source: GLEAN
Position: GCSC_97:1863586..1863100 (- strand)
Length: 487
Type: CDS
Source: GLEAN
Position: GCSC_97:1863000..1862530 (- strand)
Length: 471
>GLEAN_5090 class=GenePrediction position=GCSC_97:1864969..1862530 (- strand)
ATGGCTGCCAGCGAAACAGCAGCGGTAGCGGTCTCCAGCCCGACCAAGCCGCCCCCACCGGCTGACCCCAGCGTCAGCAA
CATGTCCAGCCCCCTGACCGAGGTGGAGGACAAGGACGGCGACCCGGACGACATGGACGTCGACGGACTCATGCACAACC
CGTCGCTGGTGAGCCACAGCCAGCTGGGCGAAGAAGACGAAGCCGCCTCACAAGCCGCTCAATCACGCCCCGTGTCCGAC
ATGGACGAAGACTCAGCCCTGTCCGAAGCCGACCCGGACATGAACGACTCCGAGGCCGAGACCGAGCGGCTTTACGACAC
GCCCATCAAGACTAAGAACATCAAGGGCGACCGGGCCCCCGACAGCAGCCCGGAGCTGAGCCCCAGCCGGCGCCTAACAT
CACACAAGCGGGACCGAAACTTCCAGGCAAGTCCCAGCAAGCTTAAGCAGCAGCTGCGTGCCGACGGCGCCGACGATCGC
ACCAACGGCCACAGCCACGGCCTAGGTCGCGGCCGGGGCAACGAGGACGAAGACGAAGACGAGGACGAGGATGAGCTGTC
GGACATGGACGTCGAAGACGAAGAGAACGAGGCCGACGGCGAAGACGAGGCGTCAGCTGAGAGTGGCCGTCATCGCAAGG
CGGCCGTCGACAAGACCGAAGACGCGGCTGACAAGGGGGGAACGGCCGTGTCGATGTCGGTCCGGAACCAGCGGTCCAGC
TCGGACACGCGAAAGCGGAAGCGGTCGCCCACCACCGATCCGTCCGAGTCGGACCAGCCACTACGGAAACGAATTGGCTC
AAGCGGCAACAGCAGCGGCAGCCACGAGGCCGGTGCCGAAGACGGGGACGAAGACACCACCCGGTCCAAGACGCCAAACG
GCAACGGCGCCGACCAGGCCGAGACTGTCAACGGCGACAAGCAGCCCGATCGGGCAAAAGAGGACACGCCTGACGGCGTC
AGCAGCGACACGCTCCGCACACGACGATCGAAGCGCGCGAGCGCTAAGAAACACAAGGGCGCAGACGAGGGTGAGGGCGA
TGGCGACGGCGACGGCGACGAGGTCGTCGAGGAGCCGGAAGACGACGTACCAGAGGACAGAGAGACCGGGCCGGCAGAAG
AAGACGGCACGGGACCGGCAGAAGATGACCGGCCGGCCGAAGTAGACGAAGAGGCCGAGGCGGCCCACAGAAACGAAGAA
GAACGTATGGGCAGACCAGTCCCCGAGGACGAGGACGACGATGCTGACCGTGATGCCGTAGTGGAACGGAAGAAGGCGGC
CTTTGACCAGCTGCACGTGATCGAGAAGCGGTTTGCCTCGTTCCGAGACAAGTAAGTGCGCGGACTCGGCCCGATCGTCG
GACCGTGTGCTAACAGAGTCCAGACTCTACCAGGAGCGGCTCGACCAGCTCAACGAAGAGGAGGCGATGCTGCGCGGCGA
CAACCCGACACACCCCGAGTATCTGGCGATGATGCAATGCGTCGACGAGCGGCGCGACGAGAAGGTGCGGGTGTCGGGGC
TGGAGTACCAATTCAGCATGAAGACGCTGCGGGCATGGGCCGTTGGCCGGCGCAGCCAGATCCACGGCCAGTACTTCCAG
AACGTGCGCGAGTCGCGTGAGCTCGTGCTCGAGGAGCTGGGCCGCCAGTGGTACCAGATCCAGCACCAGCGCCGCCGCCA
CGCCAACACCATCCCGGACTATGGCCTGCGCTTCCCAGCCTCGCCAGCCCAGCGGACAAAGGATGCCATCGCGTATAACA
AGGAGGTGTCCATCCTGTCGGGCATTGCTAAGTACGAGGGCTTCCCGGCGGCGCCACAGATCCGGGGAGCCTCGAGCGGG
CAGGTCGATGATGATATGGGAGCGATTGCAGTGGGTTTTTTTTTTCTATTTTTTTTCTATTTCTTTATCCCTTTCTCTCC
TCTATTCTCTTCTCCCTCGTCCCACTAACAAAGACAGCGAGGACGACAGGTCGGCCACATGCCAGCACCCACGGCATCGC
CGTATTTCGATGCCGGCAGCCGGGCCAACGGCAGCCTGACGCTCAGCGGTCTGGCCGCAACCGGGCAGCAGATGCTGGCC
GACGCCGCCTGGGCAGCACCACAGTCCCAGCCACTGTCCCAGCAGCAGCAGCAGCAGCAGGTCCAGATGCAGATGCAAAT
GCAGATGCAGATGCAGATGCAGCACCTCCAGCACCATCACACTTATCACCATCACCAACAACAACAACAACAACAACAAC
AACAACAACAACAACAACAACAACCGCAGCAGCACCAACACCAAGGCGCTGACGGCCAGCGCAGCCAAAACGGCCACGCG
CATCACCACCATGTGGCTGCTGTCCACGGCCCTGCTCGCCACCACCACCACATGCACGCCGGCGAGCCGTCCGCGGTGGG
CGTGCCGCCAAAGCGCGAAGCAGCCGTGCTCACATCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62