GenePrediction:GLEAN_5091 Details

Name: GLEAN_5091
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1860594..1857880 (- strand)
Length: 2715
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1860594..1860149 (- strand)
Length: 446
Type: CDS
Source: GLEAN
Position: GCSC_97:1860091..1859594 (- strand)
Length: 498
Type: CDS
Source: GLEAN
Position: GCSC_97:1859529..1859175 (- strand)
Length: 355
Type: CDS
Source: GLEAN
Position: GCSC_97:1859114..1858079 (- strand)
Length: 1036
Type: CDS
Source: GLEAN
Position: GCSC_97:1858010..1857880 (- strand)
Length: 131
>GLEAN_5091 class=GenePrediction position=GCSC_97:1860594..1857880 (- strand)
ATGGCCACGGCCTCGGCTACCAAACCGACTGGTGCAGCCATGCTAGGGATCTCGTCTGGCGGGACGGCCGCAGGTCGCTC
GTCTCTGTCGGCGTCGTCGTCGTCCTCGGCCGTGCCATCGTCAGACTCTGTGCAGGAGCAGATCCGTCAGCTCAATGACG
CCCGCAAGCTCGTGCTCGCAAACGTCAGCTACTACCCGACTATCGTCCAGGGCATCCTGCCCATTCTCAGTCCGGCCTCT
CTGCCGCAGCTGCGGCGATGGGGCGCCGAGTTCCTGGCAGAGGCATTTGCAGCCCCAGCACTGCCGTCGCGCGACAAGGA
GACGCTGAGCCTGTTGGTGCTCGAGAGCCTCAAGGGCATGGTGGAGAACGCCAACGAGGATGCGCTCGTGCTGCAGAGCA
TCGTGCAGGCGGCCGCCAGCATCTACCCGCTGGTGATGCGGTGGATGTAAGTTCCCCCCCCCCCCAAAAGTACGAGTGCA
GGCCTCGTCGATTAACTCGCCAGCATCAACAACTCGTATGACACGCCGACATGGGAGCGCATGACAGCGATCAAGTCACG
CATCCTGCGGCTGTGGGAATCGCCGGTGCCGTCAGTGCAGATATGCTGCATCAAGTTTGCGCAGCGCGTGGTCTTGGCTC
AGACTCACGGCGTCAACCAGGAGCACAAGCGTGATGGCCTCGACATTTCGCTTGGCCTCATCTCGCAGGGACACCCGCTG
CTCGACCCGCGACACCTCGAGGCGGAAGCGACGGGGCTTCTGGACCGCATGCTCGGTGTCTTGCAGGACAACAGCAGCGA
TGCGCTCATCGTCGATGCTACGCTCAACACGCTCTCGATTCTCATCCGCACACGACCAACGACGTCCAGCCGGGCCATCA
ATGCGATCCTCAGTTTTAACCCGCTGAAGCTGGCCAGCGGACACATGACACCAAGGACACGGGTCGTGGTCAGGTCGATG
GAGAAGACGACGCGGATGCTTCTCATCCACCTGACAAAGCGGTATGTTTGCACGTCGGCAAGGCTGCCCGTATAGCATAA
CACGACCTAACTTTTGCTGTCACAGGGACCCACACAACCCTTTTAACGCACGGATACACCAACACATTGAGCGGCTCATG
CGGTCGCGGGCGGAGATGCTAGACGACGGCGGGCGCAAGCGGGCGCTCGCAGACCAGCAGGCGGCAGCATATGGCGACAC
CAAGCGGCAGAGGCTGGCGACAGGAGCGGCAGCACCGCAGATGGTGGAGATCAAGCCGCTGGCGCCGGGGCAGAACAGCT
TGGCAGACATCTTTGCGCTGACGTCCAATGCACAGCAGCGGGCGTTTAGTGCATCACAAGTGCCACTAGATTTGGCAGCC
AAAATCAGCGTGTCGACGCTGGCGCGAGTGGACCAGCAGCTGCTAGACCGTGCCATCCAGGTAAGATAGGAAGAGATGCG
AGACGCATGCAGACGTGTACGGCAATGCTGACAGCAACAGGGCATTCGCGACCGGTTGGTGACGCTGGAGGCTGCCTCGA
CGCATCTGTCGCTGCTCAACCCCGACACGACGCCCCTCGATGTGGCAGACGACGACGACGATGACTACGAGCCGGACTTT
TCGACGGCAGAAGACGCGGAGCAGATCCTCAACAAGTTCGACATGGACGACGGGACCGGGCGGGAGGTCGGCAAGGCAGA
CGTCGGAGCGGCCACGGCAGCAGCAGTAGTAGCATCGTTGGCGCTGGGGGCATTCCATCTGCCGGTGGCGCCGCCGCTGT
CAGCAGAACAGGCAGTGAAGGTGGGCGAGGCGACGGTGGCACGAGTATTTGACACGATGCAGTCGTCATCGGACGTGACA
GCAGCAGCAGGAGGAGGATCGTCGTCAGGGGCTGTAGCGTTGCGCAAGGCAGGCAAGACAGCTGGGCTGGGCCGCGTGGC
GGCGAGCTCTTTCGACAGAGAGTCATGGACGACGATTCTGACGCGACTGGCGACGCGGTCATTGAGCGGACTCGAGGGAG
AGGCCGAAGAGGAGGACGGAGGGGGTGACGAAAAGGCGGTGACTGCGGCGATCAAGAGAGAAGGTTCGGACCGTCAAGCA
GGGACGCTGCTGAACGACAGCATCCGAGAATCGCTGTTCCGATATGTGCTGGAGGACTTTCGGAAGCGGATCGACGTGGC
AGTGGCCTGGCTTTGTGAAGAATGGTACAACGACCAGCTGGAGCGCAAGTACGGCAAAACAGAAGGCAGCAGCAGCAGCA
GCAGCAGCGACATGGGCGGACGACACTACGATAAGTGGGCGCTGCGCCTGCTGGACGGCTTTCTGCCGTATCTACACGGA
CAGGACAATAAGGTGCTGACGCGGTTTCTGAGCGAGATCCCGACATTGAGCCGCGGGCTGCTGCAGCGCGTCAAGAGCCT
GTGTCGCGACCCGTCGATGGTGCCGGTGGCGCTGACTAGCCTGCTCTATCAGCTGATGATGCGGCCACCGGCACGGGCGC
TGACGCTGGACACGATGGAGGAGATATGGATTGAATGTGAGTGAGAGAGTGTGTTGCAGGAGACCGAGTGAACGAGTGAA
CGAGGTGATGCTGACTAAGCACAGACGAGGATGCACGACCCATGGCGACCAAGTATCTGGACAAGTGGCGGCCAGGGTTT
GTGCAAGGACAACGAGCGGCAGAGGAGAGCAGCAGTGCGGAAAAGGCTGAGGGAGTGGCAGTGGTGGCATCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62