GenePrediction:GLEAN_5095 Details

Name: GLEAN_5095
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1849892..1848449 (- strand)
Length: 1444
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1849892..1849815 (- strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_97:1849681..1848449 (- strand)
Length: 1233
>GLEAN_5095 class=GenePrediction position=GCSC_97:1849892..1848449 (- strand)
ATGGATTCCACCACCTCCGCACAAGGCTCTGCCGGTTCGTCAAGCGCGAATAGCAGCAGCTGGACCGCATTCCTCAAGGT
AACTTACTTCCCGCATTCGGTCCTTCAGGCTTCCTTGGAGCTTTCTTCAGGCCTCAAAACCCTCTATATGTTGCCTGCGT
ATACTTCAATGGCCGAGCTGCCCCATCGTGCTGACTCTGACCTGCCTGCAGTCGATTGCATCGTTCAATGGCGACCTCTC
CAGCCTGACGGCCCCGCCCTTTATCCTTTCAGCCAAAAGCTTGACTGAATTCAGCTCCTACTGGGCCGAACACCCGGCCA
TCTTTGCTGCCCCGGCCAGCGAGCCCGATCCCGAAAAGCGCGCCGTCCTGGTGCTCAAGTGGTTCCTGACTACGCTTAAG
CAGCAGTATGCCAGCCGCAGCGAGCAGTACGGCAACGAGAAGAAGCCGCTCAACCCCTTTCTGGGCGAGCTCTTCCTCGG
CCGCTGGGAAGACGAAGAGTCCGGCACCACCGAGCTTATCAGCGAGCAGGTCAGCCACCACCCGCCAGCCACTGCCTACA
GCATCACCAATCTTCCCACCGGTGTCCATTTGGAGGGCTACAACGCCCAGAAGGCCTCCTTCAGCCGCTCCATCAACATC
AAGCAGATCGGCCACGCCGTCCTGACCGTTCCCGTACCAACATCAGCCACACAAACACCCGCGTCAGCAGCCGTCAACGG
CAATGGCACCACCGATACTTACGTCATCACGCTGCCGGCCATCCACGTCGAGGGCCTATTTGTCGGCGCCCCCTTCCTCG
AGCTGGAGGGCTCAACCTACATCACATCGTCCACCGGCTACACAGCGCGCATCGACTACTCCGGCCGCGGCTGGATCAGC
GGCAAGAAGAACAGCGTCACTGCCGTGCTGTACCGCACTGGCAACGAGCGCGACGTGCTGTACCATGTCTCCGGCCAGTG
GACCAAGGCTTTTGACATCTTCAAGGGCCCTGCCAAGAGCCAAGACCTTTTCATCAGCTACACCCCCGAGTCCAAGCCGA
CCACCCCGCTGATTGTCGAGCCCATCGAAGCCCAGCACCCGCTCGAGAGCCGTCGTGCCTGGGCCCGTGTTGCCGCCGGC
ATCGCCAAAGGCGACCTCGACGCTGTCGGCCTCGAGAAGGGCAAGATCGAGACCGCCCAGCGCGAGGAGCGTACGCGCGA
AAATGCCGAGGGCCGCGACTGGACCCGCCGCTACTTTACCGACGCAGCTGCCGGCCGTAGCACTGCCAGCGATCCTGCCC
TTGCTGCCCTTGGCAGCGCCGCCGGCCTGTCCGCCAATGGCGACTGCGACAAGACTGGCGGCCTCTGGCGCTTCGACAGC
GCAAAGGCTGCTGCTGTCCGCCAAAAGGGGCCCCTGTCCGAGGCCGAGGCTGCCGAGCTGGCCAAGCGTCTTCTAGGCCA
GTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62