GenePrediction:GLEAN_5096 Details

Name: GLEAN_5096
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1841889..1841031 (- strand)
Length: 859
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1841889..1841788 (- strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_97:1841720..1841031 (- strand)
Length: 690
>GLEAN_5096 class=GenePrediction position=GCSC_97:1841889..1841031 (- strand)
ATGGCACCAAAGGTGCACAAGAAGTCCAATCGGGCCAGACACCGATCGACACTGTCGCTTCAGAAAACAGAGGTCATTAT
CAATGTTTATGATCTTCTAGCAGTAAGCTTCAGCATCGTCTCATTTTGATTTGATTTCAACAGTCGCATACTGACAATTT
GTTTCGCAGCCCGGTCGCCTCTCTTCCTTCCTATGGTTCGTCGGCACATCTCTCTTACATTCGGGTGTTGTCGTCAATGG
AAGAGAATATGCTTATGGTGGACATGACCGTCATGGAGTCACTGGTGTCTACTGGACTAAGCCTCGGTCGGAACCTCCGG
GTGGCACATTCCGCTGCGAGATTCTGCACGGCTTTACTTTAGCTACTCCCGATGAGATTGAAGCCATCATCCGCACCACC
TCGGCAGAGTTTCTCGGCCCTTCTTACAACCTTCTCACGAGGAACTGCAACCATTTCACTGCCTATTTATGCCGCAAATT
GACCGGCCGTCCCGGTCCTCCTTGGCTGAATCGTGCTGCGAGTATTGGCGTTGCCTTACCTTGCGTTGTTCCGCGGGAAT
GGATCGAGCCACCGGAGTACGACACTGCTGATGGCGAGTTGCTATTAAGCGACGACGAAGACGATATACACGATGAACGA
ACGGGCATTTTGCGGGTGTCTTCGCCACAAGTACACCTGATTAGAGCAGATTCTAACGAAGGTACAAGCGCCAGCGACAG
ATTGCAGCAAAATTGGGATGATGAGGATGAGCGGAGAAGTACTGGAAGCGGCGAAATGGGGAAAGGCAAAGGTAGAGCCG
GGCCTATGCGAGATTGTGAAGGACGAGCACTACCGCCGTCCGAGCGTCTGCGAGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62