GenePrediction:GLEAN_5097 Details

Name: GLEAN_5097
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1829710..1823384 (- strand)
Length: 6327
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1829710..1829522 (- strand)
Length: 189
Type: CDS
Source: GLEAN
Position: GCSC_97:1829422..1827752 (- strand)
Length: 1671
Type: CDS
Source: GLEAN
Position: GCSC_97:1827686..1825356 (- strand)
Length: 2331
Type: CDS
Source: GLEAN
Position: GCSC_97:1825029..1824742 (- strand)
Length: 288
Type: CDS
Source: GLEAN
Position: GCSC_97:1824691..1823384 (- strand)
Length: 1308
>GLEAN_5097 class=GenePrediction position=GCSC_97:1829710..1823384 (- strand)
ATGGTGTCTCTTCGCCAGCGTGCGCTGGACAAAATTGCAGCTCTTTCGGCTACGAACTCTGAAAAGCCTTTTGAAAAATC
CGACCTGGATCGACTCTGCAAAGCTTGTCCCAACCATATCAGGGCTCGCGATGGCACGAATGGTTACGCCTCACGGCAGC
CAGCCTCTCTTGCTGGCCGTGTCCCCATGGTAGGTGGAGGTTGAGATTCGAGAACGCAGCTATTGTCACCGGACAGATTT
GTGATCGCTAGTATTTCGCGATTGCAGACGAAACTGATACATTATTAGACCATCCGCGAATTCGAGGTTCTCATGGCGCT
TTGCAAAGCCGCCCCCCTAATCCAAGTCGGCCAAGGCGCCCAAAGGCTCACCCGGCAATTGATTCCCTACATGATGGACT
CCCATATCCAGAACTTCTCCCCGTCTCCATTCTTTCGACATGTTGAACCATCTCCGGCCGAATCCCTTGCTTTCCATGTG
ACGGCCGCACTCCTAGCGCTTGGCATCAATCATATCGACATTCACGAAACTGTGTCTGATAGTATCTGGGCCTTTTTGAA
TGCCTGCTCCCGTACGACCGATAATATTCTCCCATCTACGTCTTCGATGCATGCCAACGGCAATGGGGCTGCTCTAAACG
AATCAGACGACGGCAATGTAGAAGATGCCATTCGTACGGCGACCATAGCAGTGGCGCTTCTAGGCTTCCTCAACGCTGCT
GCCGCGCAGGCCGAGTTCTGGCGCTCTGGCGGTCGCCTGGCTCTTGTTTCACGACTTCGGAAAATGCTTTCAGAACCGTT
TCTAGTCGCCGTTGAGACTGCCTTTTCGACTATCCGCAACTCTCACTCGTCTGACCGTCTTACGAAAGAATGGAAACGAA
ACCTGCGACACTATTCCGAGATGGGTCGCCCGCTCGGTGCAATGCTACTTCAGCAGAGTTTCATGCAATTACTCGTGGCA
GCGACATCACTTTTGGTGGCTGAAGTACCAGCCTTGCATCGGAGCCACGTGCTGGACCTTTTGACTTCAGGCGATGGCCT
GCTCCGACCTATGACTGCCGGCAGTGGCGATATCGATTTTCAGTCAGTCGAAGTTTACACCAATGCCGTCGTCGACCAGA
TGAACTACCTTGACGCTAGCTCCGACTTCATCCGCTTGGGTTCGACAGCTCAGCAGAAGCTGTCCCTGTCTGTGAAAGCG
TCGGCCCTGGTCAGCTATCTGATTTGCTCCCGGCTGAAAGGGGATGCTGCCGACGCCGATACTCTCATGGGCTGGCTCGA
AGACACGTTGGCAGATCCAGGACAAATGGCCGACGAAAGTCTGGCTGCAGTCGTGCTGAAATCCATGGCTCTGGTCTGCA
AGATCTCCCCGGTATATGCGGCCAACGTTGGAAAGCTACTTCCCCGGTACATCGTTCAAAGTGGCGCTCAGGGGGTGTCT
ATTGACATCGCTTCGTCAAGCCTGGCATCTGTGTTGCATATGATGTCCGCTGACGCCATAATAACCACGTTATACACTCT
CGGCAATGTGCTCAGTCCCAATACCGAACGCTCCCTAGCCAATGGTGTTGTCGATACTACCGGCGATGTCGGCCAGGTCA
TGGCCAGCAACGGCCAGGATGGCACGGCACAGATCTACCAGGGTCGACAATCGACCGGGAGCTCGATCTCTTTGCGAACC
CACGACGATGAAGAGGCCTCTATCATTTACGCCAACGTGGTACAAGCCATTTGCGGTATTGCTGGCGCTTGCAAAGACAC
AAAGATCAGTGCCCTTGCACAGTCTATGCTGCTGCAGAAAGTGGGCAAGATCAACAATGCTGTCGACGCAGAGATCATCC
CAGCTGCTGCGGTTCTGGCTTTGAGTAGCGGCCAGCCCGAGTTTCGCTCTCTGCTCAAAACGTATACGCGCATCACACAC
CTTGCTACAGTTGAGAACAAAACAATTGTTCTAGATGCGGTGAGTTAGAACAAACGCAGACATTTCTGACTTCTGAATAG
CACAATGGGAACTAACTTGCTAAGATAATGATTGCCCGGAACTACCTGTCCTCTCATCTTTGTCGAGACTCTCCTCTGTA
CGAGATCTACTGGGAGCATATGATGGACGACATTATATCCAAAGGTGATGTGCACCAGACACACCATGCCAAGGAGTCGG
ATATTGAGCTGGCCGCACGGGAAATTTCGCAGCTACTACAGCCAGTTGCTGTGTTGATGTCAGTCAACAACCTGGCTCTC
GACAGCTTGCGCGATGATGATGCTCACGCCCTGATCCGTGATGCCTGGTTCAATATTGTCATTCACGGCTTCACAGCAGC
AACCGATCGTGGCAAGAAATACATCAACGAACTGCGGCTAATCGCTGTGCATTCGCCGCCTCTGGTGGCCGAGCAGCGTG
GCGAACAGGTTGAGAGCGATATCGAGCTCAACACGGTACTACGCCGTGGCATGAGTTCGGAACGAGAAAACATGCAGAAG
AAGCATTTGTCTGAACTGGTGCCTGGCAAGGCGTCAGAGGTTCGGAGCCTTAGCTACCGCAAGGTCATGTTCTTGCAAGC
TGCATATCTTGTCGAGAGTTTACGCGCCGACGCCGGCGACTGTACCAAGGCCATTTCATATTTCCTGGAACCTAGTGCTC
GCCGTGGTGATGTTAGTAGCATCATGGAAGGAATCACGACAATTGTTGTCGACAAATGTGTGACGAAGACATTGTCAGGT
GCCGATGTCAGTTTCTCGGCCCAGTTTGCTGCCACACAGCTGGTCTCGCTCTTTTGCAGCTGCTGCCACCGCATTGAGCG
TGTCCAACAAGCAGCATACATGTGCGCAGACCGGATCATTCGCGACGTGCCGTCGGCTCTGTGCCACAAGTCGTCGCTCT
TTGCCTTGTTGGAATTGCTGTCGCTGATGTGTTTAAGCTGCCTTGAGGCAGAGACCAACATGTACGAGCCGCGCAGCACG
TTCCGGTCGGAGCGTAGCAACATCACTATTGAGCTGTCAGACGATTATGCGCTGCGGCGGCTCACGTTGAACACGCTATA
CAAAAAAGCAAAGACTTGGATGACAGGCGTCATCAGTCTGGCACCGGCCGATGTCAAGGGCTTGTTGCAGACCTATCTGT
CTGAGTGGGATGACAATGGTACTTATGGCCACATATCTTTTGGCCGGTCGTTTGCGATGGAACTTGGGTTTTCTATACCG
GCAAGCAACCAACGACTGTCATCGCTGGATCGCATCGGCGAGTGCAATATCAACATGGCATCCGACTTTGTGGCCCAATA
CACCGCACGCCAAGAGTATCGCTATGCAGAGCCGCTGTCGGACCGCGGCCTAGAGTGGCTGAGCTTTATGGGGATGGATC
GCCGCTCGTCTCTTCTACCCAACCCTGACGCCGAAAGTGCCGACGCAGTCAGTGCTCTGGCACATATCGAGAGTCGCCTG
TTGCAGAAGAAGCCGACACCAATGGCGGATGTGAGCGATATCCTCAGGCGGGCAGCGTCGGTACTTTGCCGCAGCCAGGA
CGACCAGTGCTCCATTGCGCAGTTTTTGGTCAGCATCCCATTTTCAATGTTCACGAAGCAGTCAATCAAACTGGGCGTTT
CGCTGTGGCTGGGCGTGATCAACGAAAACCCGCGCATGGAGCCGCGCATTCTCTACACTGTGTTGCAGCAGTGGGAGCTG
ACTGTACAGAAGCGGCAGGGGCTGTTCAGCACTGCCGTTGTCGACAAAGACCCGTTCCTTGTCAAGATGGAGTTTTCCCC
GAGTGACAGCACGTCGATGGCCAAATACCAACAACGTGCGCATAACATGTTGGCGCCACACACGCGGCTGTTGCAATTTC
TGCGGAGCCATTTCAATGCCACCCGACTGGGCAGCGTGGATATCCAAAAAGCTTATCTGCGCATGCTGGATGTGACTTTG
GATGCAGCCAAGATACTGACAAACACGCACCCTATGGCTCGCGAACTGTGGTTCCAGGCTGTGCTGTTCGGACTGCATGT
GTTGCGCACCAGTTCAACAATTAGCCCCGTTGCACAATGGCGCCTCAAAGACAAGCTACTCTCAGCTGCACTGAGCTGGT
TTGCCAGCCCGCCCAAGTGGTCATTTGGCAGCAACAATCTGCAGCTGAAGACGGAAATTCGACTACTGGCCGACGTGGCA
GTGGCGGTCAAGGCCGCTAGCTACATTGGCCTGCATCAAGTCAGCAATAGCCTCAAGTCGCTTGTGGCAAAGGAGCAGCT
TCTGCTTTTGCTTTTAGAGAATGAACAGGCGCGGCTTTTCGTCTGGGTCTATCCATTGGGCGAGCCACCCAAATCACCGT
GGAACATTGCTCAGACGGGCAAGGGGATGGTAGATGTAAGGGTTGAGTGATGCTTCAAGGTGCTGCAAGAACCGCGTACT
AATCATAATATATATAGGCACTGGAACCTTTGGTTCGCACAGCGTGGCAAGAGAACCCCTCTTTGGCCGTACAGCTAGCT
GCCCGATTCTCGAACGTTCGGATTCAGAAAGCTGTTCGTTGGCTGCTTTTGAACTTCCCGTCCAGGGCCATAGACGAACC
TGCAGCATCGTCAATCATTCTTGATAAAGCCCTTCCCAGTGATGTGAGCTTCCAGCTAAAGGTAACCAATTCCCAGTTCG
ATCTCATCATTGGCAAATGTTCAAAGTGCTAACTAATTTAGTACATGCTATATTGGGCACCGGTCAACCCCATGACAGCT
GTGGCATACTTCCTGCCAGTCTTTGAGAACCACCCGTTCCTCATCCAATATGCCATGCGGGCCTTGGAAAGCCATCCGGT
GGATATTACGTTTTTCTACGTTCCGCAGATTGTACAGACGCTCCGTTACGATGCGCTAGGCTACGCTGAACGCTACATCC
TCGAGACGGCACAATTTTCGCAGCTCTTTGCCCATCAAATCATCTGGAACATGAAGGCCAATGCCTACAAAGATGACGAA
GCTCTAATCGTGGGTCTCTCTCCATCTGCCTAATACTGGTATACAGGCTAACAAACCAGCCCGACGCTATCAAACCGACC
CTGGACCATGTCATGACACAGATGACCACATCTTTCTCGACCGTCGACCGCCAGTTTTACGAGCGCGAGTTCACATTTTT
CGATGAAGTCACGGGCATCTCTGGCAAATTGAAGCCATTCATCAAGAAGTCAAAGCCAGAAAAGAAGCAGAAGATTGAGG
AAGAACTGCGCAAGATCAAGGTCGAAGTAGGCGTGTACCTTCCAAGTAACCCAGATGGTGTAGTTATCGGCATCGATCGC
AAATCAGGAAAGCCACTACAGAGCCACGCCAAAGCACCCTACATGGCAACGTTCAGGATCCAGAGATCCAAAACGGGAAG
TGTCGAGGAATTGCTGGAAGATGTCAACGAAAATGCGGCTATAATGGCTGCAGGCAACAGCAACGGCGCACTCGTGAAAG
CATCCGCCAAGATTAATGGAAACGGAGCCATAGAAGCAGTCAACGGCAGCGCCGGCGCAAATGATGAGCTTGCTGGCGAC
CATAACACTATTGAGGTGTGGCAGTCGGCCATCTTCAAAGTGGGTGATGACTGCCGGCAGGATGTTCTCGCGCTGCAGAT
GATCTCTGCTTTCCGGGGCATTTTCCAGAGCGTCGGACTGGACGTGTATGTGTTCCCGTACCGGGTGACGGCAACGGCGC
CTGGTTGTGGTGTGATCGATGTGTTGCCCAACTCGGTGTCTCGAGACATGCTGGGCCGTGAGGCGGTGAACGGGCTGTAT
GAGTACTTCATCTCAAAGTACGGCAACGAGAATTCGTTGAGCTTCCAGGCGGCGCGCAGCAATTTTGTGAAGAGCATGGC
AGCCTACTCGGTCATTTCATTCCTGCTACAGTTCAAAGATCGACACAACGGCAACATCATGATTGACGACGCAGGCCACA
TACTGCATATCGATTTCGGCTTCTGTTTTGATATCGCGCCTGGTGGCATCAAATTTGAGCGGGCGCCTTTCAAGCTCACG
GCAGAAATGGTGGCAGTCATGGGTGGCAGCACTGATCACCAATCGTTCCGGTGGTTCGAAGAGCTGTGCATCAAGTCATT
CCTGGCGGCGCGGCCTTTCACAGAGAAATTATCGCAGATCGTAATGCTCATGATGGACAGTGGGCTTCCATGCTTCAAGC
CAGAAACGGTACAGCACTTCCGAGAGCGATTTGTGCTTGAGAAGACAGAGCGGGAAGCAGCCGACTTTATGCGCGACCTC
ATCAAGAAGAGCTACGCGAGCTACTCGACCGGTCTGTACGATCAGTTCCAGTGGATGACGAATGGTATTCCGTACGCATC
GAGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62