GenePrediction:GLEAN_5098 Details

Name: GLEAN_5098
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1821718..1818484 (- strand)
Length: 3235
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1821718..1821682 (- strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_97:1821539..1818484 (- strand)
Length: 3056
>GLEAN_5098 class=GenePrediction position=GCSC_97:1821718..1818484 (- strand)
ATGAGACCGAGCTCCGTGGACCACACGCCGGATACGAGTTTGACAATCGCATAAGAAATGTTTACAAGGCCATATTGTTG
TATTTAGTAGCACTAGATGCTTTCTTGAATCGATGTGCAGCTGGTAAGATATCTATCTCTACGTTCTATATTTTGCACTA
ATAACGAATCTACTGCCAGGACGAATCGGACATGCATTCGGGAAAATCGAAGACCGCACCATCTCCCAGAAAAAAACGGC
GATTGACGAAGCCGACAAAGAAGTAAAGGACTGGATTCCCATCGTCCAGCTCAAAAGCCAGAATCACGGATTCTCGCAGC
TGCAACAGAAATCGGACAGCAATCCGTCTCCCGCACCGCTACCAACAAAGGACTGCTCCATGTCGCTCGCATTTGAAAAG
ATGGACGAACGATTTGGAGGAATGGACACAGCCAGAGATGGCACATGTGATTGGCTGTTCCGACACTCTGTGTACAAGGA
CTGGGCTGCAAGCAGCAGTGGCTTGCTCTGGATTAAGGGTAAACCGGGATCTGGCAAGTCCACGTTGCTCCGTTTCGCCC
TCAGCAAGTTCATTTCTGACTCTCTATCCCAACACAATCATACCGACATCGACGACCATCCCCCTCCTATTTTGCTGTAC
TTTTTCTTCCACGGACGTGGTATCGAATTACAAAAGACGCTGATCGGCCTCTTTCGCACTATGCTGTACCAGCTGCTCAA
AGAGGCTCCCGATTCCTTGCAAGAACTTGTCGAGACATATCAAGACCGTTGCCAGAGCAGAGGCAAGCCGGGGAAAGAGT
GGCACTGGCAGCTAAAAGAGCTCCAAGATTCTTTGCTACACGCACTACTCTGTGTTCTAAAAGTCCGGCCAGTACAACTA
TTTGTTGACGCCCTCGACGAAGGTGGCAGGCAAAATGCTTGCGATGCCGTGGAGTGGTTCAAGCTACTACTGAAGCGCAT
GTCTGCCGCCGATACTTCAAATTCTAGCTTTCCGTGCCATGTCTGCTTCACTTGTCGTCATTACCCCATCCTCAGCCTAG
ATGGTGGATTTCAGATATGCGTTGAGCACGAAAATGGCCAAGATATCTCGACGTATGTGCACGATCGGCTATCAAGCTCC
CGTATATCACCCGAGCTCATTATACAAAGAGCCAATGGCGTCTTTCTGTGGTGTCGTCTTGTTCTGGATAAAATCATACC
GGGTGAGATGGACGGGGATGGCGACATCGAAAAGCAGATCGAAAGCACACCGCCACATCTCGATGATCTATACCTCAATC
TTATAGACACCGTGGACAAGGAAAAAAGAGCAATCTCGCTACGGCTGATGCAGTGGGTATGCTTCAGCGCTAGGCCACTG
ACCTTGGATGAAATGCGTTGGGCCCTAGTCGTGAGCGCGCAATGTCCACATCCTTCCCTGGAGCAGTGCGAGTCTGACAC
AGACTATGCGCCTAACAACGAAACTTTGAAGAGAAAGCTGAAGCGTTTAGGATGTGGTCTCGTGGAGACAGTGCTGTCTG
TCGAAGATGAAAAGGTTGTGGAGATCGTACAATTCATTCACCAGTCAATCAAGGATTTTTTTTCAAAGGTCGGCTTGCGA
GCTATGACGGGCGATAAAACGACATCGAACACAGGCATCGTCGACACCTCGGGTTCTGAAAAGGCCATAATCAACGTGGT
CTCAGCAGCCCACTATCATATATCTAGGTCCTGCCTGCGGTATTTAGGGATGGAAGAGTTCGACGAATCGAACATGCTCT
TCTTTGGTGAGCGTGACCAACTAGTCCGAGCTTTCCCCCTGGTACAATACGCCGCAACACTGTGGGAATTTCATGCCAGG
GAGACGGAAGAAAGCGAACAGGCCGACATTCTGGAATATTTCTCCTGGCCCTCGGACACTATGCTTGAGGACTGGATGCG
AATACGTTTGCTTTTGAACGCACACCCGAGAGACCGCCTGCCACACAACTCTAGCTTGATGCACGTGGCAATATATAGTC
GCTTGCCAGGACTATTGCGAGCACTTGTACAGAAAGCGCTCGCCGTTGGTTTTGATATCGACCTTGGGGACTCTGGAGGG
GACTCGCCGCTGCTTGTGGCTGCCCAAACCGGACAGGAAAATGCGATACGGCTTCTGCTAAATACGGGTGAGGTCGACGT
CAACAGGCAAGGCCGAGACGACTACACACCACTGTCGTGGGCAGCGAGCGAGGGTTATGTATCCATTGCTAAGCTTCTTC
TCGGGATGGAGGCGACAAATATCCACTTAGAGGACAGCATTGGATGTACACCGCTAGCACTAGCAGCCATAAATGGTAGC
AAGGTCATCGCACAAGCTCTGCTCGATGCTGGAGCTGTTGTCGACTCGAAGGATCATGACGGCGACACCCCACTCAAGGC
GGCCGCAGAACATGGAAATGTGGAAGTTGTAAAGCTACTTCTGGACACTGGAGATGTGGACACAAAAATCGAGGATCGAA
ACGGCTGGACGCCGTTGGTGTGGTCTGCTAGGAACGGCCACGACCCCGTTGTGCGGCTGCTTCTCAGAATGGGTAATCCT
GATGTCGACCACAAGGACATATATGGTCGCACCGCACTGTCATGGACGGCAGAATATGGACACTCGACAGTGGTATGGAC
ACTCGTCAACGTGGGCAAGGCCGACATCAACACGAAGGACGACGAGGGAGCAACACCGCTTTCATGGGCTGCTAGAGAGG
GACAGGGTACGGTTGTGAGTGTGCTTTTGCTGCACAAGGAGATTGATGTCGACTGCAAAGACTGCGAGGGCCGCACAGCG
CTCTTCTGGGCAGCCAAGGCCGGCAGCGAGGCAGTTGTGCGGAGGCTCCTCGAGACAGGCAAAGCGGACGCCAATGTGAC
GGACAAAGAGGGCGACACCCCACTGTCGGTGGCAGCCAAGAAGGAGCACCATGGCGTTGCGCAGCTGTTGCGGCCGTTAA
CTGCGACTCGCCCTCCCCTCAATGAACGAAGCAACAGCATTTCGCCAAACGAGGAGGACAATGCGACCGAAGTTGGAGAG
AGTCCTTCGGTAGATGGCGGCAGCCTGACGACGGCTGGAGACAGCTATATATCTGTCAAGGACCGCTTCTCGGCAGTCGA
TGTGAGCTTTGCGGCAGTCAAGAACACCAGATTTGTGGCGGCAAAAGACAAGGATGACAATGTGGTTTCGTCAGTTGAAG
CACCATTAGCGGCCATCTCGATTCAGGCGGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62