GenePrediction:GLEAN_509 Details

Name: GLEAN_509
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:245631..250476 (+ strand)
Length: 4846
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:245631..245994 (+ strand)
Length: 364
Type: CDS
Source: GLEAN
Position: GCSC_97:246155..247889 (+ strand)
Length: 1735
Type: CDS
Source: GLEAN
Position: GCSC_97:248140..249091 (+ strand)
Length: 952
Type: CDS
Source: GLEAN
Position: GCSC_97:249205..250476 (+ strand)
Length: 1272
>GLEAN_509 class=GenePrediction position=GCSC_97:245631..250476 (+ strand)
ATGGGTCAACAAGCCCCGTCCGGCAAATACGAATATTCGTATGTCGACCACCCTCTGGCCCACGACGATGGTGGTCCTGC
CAGTTGTGCTCACTCTCCGACGTCATCTGTCAACGCAACGAGCTGCAACGATAGCCGGTCTGTTTTTGGAAATCTAAACG
GCCACGCCAGCCTGAACGTTCAAGCTGAAAGTATCACTACACCACTTGACAAGTGCATCGCATCAGACAAGCATTCAGCT
AGCAACGTCACACCGGAATCTCTGGCCGAAGATTTGGAAAACTTTCACCTGAACAATTCCAGAAGAATTGCCAATCGTTC
TGTGGAGAAGTGCCTTCTGTCGGACAAGGATATTACAAACCCAGGTACGCCCACAGACTGTCGCAAGCTTAGACAGCAGC
GAGCCCACCGCGCGGGCGCGGGCGAGGCATGCGAATCGCTGGTCCTCTTGTGTTTTGATGCCCGTGTCATCAGTCTTGCT
GTCCCGGCGGCTGGATCATAGATGGCTAACTTGCGGCTTTTCAGGAGACTTGTGCCAGCATCGATCAGAAGCAACGCTCG
TTAAGAATCTAGACTTTCAACAGGCAATAGAAAAGCACGAAGTCAGGGAGTTCGAGTGGGTGCTATCACTGCCCTGCAAC
GACGTAGGCCTAGCTAAAGGCCCCGACGACAAGAAGCCTAACCGAAGCTGCTCCGTTCCCGGTGCGGCAGACAGCGGCAG
CGAAGATCGACAGATTCGTTTCGGCTGCAACCTGCTGCAGAATAGAGCGCGAGCCGGCAGCGACCTGGCAGGACAGCACC
GCACGATCAACACATACACGCTCGTGGCTACACCTCTGGGAGACGAGGTGCTGAGAGGCGATCAGACAGGCTCATCGCAG
TCGCAGACGGTATCAGTGAGCCAGACGGCATCGGCAGGAGAAGCAATCCCGATGGTGGATACATTTTTGACCCCTGAGCG
TACGGCGCCAGCGGGGGTTCGTGCAGGCAGAAGCCGGTCCCAAGTCACGCCGCTGATGCTGGGTGATGGATTTGAGGCCG
GTTCTGCAGACCGGTCCCGTTCGGCCACACGGTCGCCAGCCAGCTCAGTGTCGCGCATCGAAGACACGATCGAAGAGCTG
GACCGTCTTGAGGACGAGTTTGAGGCTGTGCATAGCCTAGTGCGGGTCGAGCACGTCCCGTCGCCGGAGAAGCCGGACGA
TGACAAGGCGGCTCGTGTGGCAGCAGTGGGCAGAAGTGGCAGTACGAGAAAGGTTGTGGTTGCGAAAGCGGGCGGAGTAC
GGGCGGAGCTGAAGGCGACGGCAGGGATGACGCGGACGTCATCGACCCGCAAGCCGGGGGTGGCACCGAGCCAGGCAAAG
AAGCAAGGCGGCCCAGCCGAGACCGGGACGGGACCAGGAAGTGGCATCAAGCGGATGAGCATAACGCGGCCGGCCAGTCT
GCTGCCGCCGAAGCCGCCGATGAAGTCCAGCAAGCCGCCGACGGTATCGACATTTGAGCTACCGGGCGAGGCGGTGGCGC
GGCGGCTCAAGGAGCAGCGCGAGAAGCGTATGTCGGCGGCGCTGTCGGGGAACGGGATTGTCGCACCAACAGCGACGCCG
GTGCAGACACCACGACGAAGACGCTCGGTCAAGCCGCCGACGATCCCAGCATTTGAGCTCCCGGGCGAGGCGATCTCTCG
TCGCAAGCGGGAGGAGCACGAAGCGAAGATCAGGCGGCAAGAAGAGGAGGAGAAGAAGCGACGGGAGTTCAAAGCGCGGC
CGATGCGCATGAGCACGACGCCGAGCTCACAGCCACGCGAGACGGTGGCCAGCCGAGCACGAACAAATAGGATGTCGATG
ATCGGAGAGAGCGGATCTGCGGGTGGGGGGCTTAGTGTGGGCGGATCGAAGCGGCTCTCGGTGTCGACAGCATCGCCGGG
GCGGTCGATGCAGCAAGCAACGGGTCGCGGGCGAGTGTCCAACGTGGAGACTCAGTCGGTGGAGTCGCGTGCCAGCCGGG
CGACATCGTCGTCGACGTGCAGCATGAGCGGGAAGCGAAGCTCGGTGTCGGCGGAAGAGGTGCAGCAGCAGAAGCTTCGG
GGCAAGGACATCTACCACCGAGACAACTACCTTTCGGTGGACCGGGACCAGGAGAAGCGAGAGCGCGAGGCGATAGCGAA
ACAGGCGCGGCAAGAGGCAGCAGAGCGGTCGAGGATTCTCAGCCGGGAGTGGGCAGAGAAGCAGAAGCAGCGTGCGAAGA
AGCTGATGACGATTGGATCGTGAGTGGTGAAAGTGGACAGTTATGGTTACGAGCGAGTGTTTTTTGCGCAGTGTAAGAGA
CTGTAATGTTTTGGGGGTGTTTCTGGTGGGACGATGCCGATGCAGGGGCAAGAAGAGGTTGGAGTGGCTGGCTACGGAGT
ACTGCATTTATTAGTATTATTTTTGGAAGCACATGCTTTATGTAAGCGTGTATTATTGTATTATTATTGTTGTGAAGTGA
CATGTCCGTTGGCAGCCTGTTTTTGGAAGGTCGGTCAACAAGCATCAAGACGTGACAATGGTGCGACACAAGAACACAAA
GGAGATGAGGTCGTCGTCGTCGGTGTCGATGTTGTCGTCGTCCAGGTTGTCGTCGTCGTCGTCGACTCGGTTACGGCCAC
GCGTGCGACTGCCGCAAGGAACATATGAGGGCCTCGTGCTGACGGTGGGCCAAGGGGTGGCGGAGGGCGTCAGAGGGGGC
AGCGGGGGCCACGAAGCACAGGCTCAGCTGCCGCGACCGGTGGAGGCCTTTCTGGGGATTCCGTATGCGCAGACGACGGC
GGGGCGAAACCGGTTCCGGGCGCCAGTGGCGCTGGCGGTCGACGAAGCCGGCAAAGGTGACGATGGGCGAGTGCACGACG
CGACCTGGTTTGGGGCGCGCTGTGTGGGAGCGGGTGGGCGAAGCGACGTGGCCGAGAGCGAGGACTGTCTGAACGCGAAC
GTGTATGTGAGCGAGGGGGCGCGGGGTCGAGGGAGAAGGAAGGATGAAATGGATGGCGAGAAAAAGTACGAAAGCCACGA
AAATCATCACGACAACAATCATCGCGACAACAACCACCACAACCATCCCCCGCATCATCATCACCACAATCATAGTCTCC
TTCCGGTGGTGATCTACGTGCACGGCGGCGCGTTCAACAGCGGCTGTGGTGCCGAGCGCGATCTGGCCAGCTTTGTCGGC
CATGCGGCCGTCGACCTGGTGGCTGTCAGCTTCAACTACCGCGTCGGCGCGCTCGGCTTTCTCGGCTGGTGGTCCGAGCG
GGACGGCGACGGCGACGACAAGGAACCGCACGACGGCGACCACGACGACAACAACGCGCCGCTCAATCTCGGCCTGCTCG
ACCAGCAGGCACTCTTTGGCTGGGTACAGGCCAACATCAGCTTCTTTGGCGGAGACGCGGGAAACGTGACGGTAATGGGA
CTCAGCGCAGGGGCACATTCGGTGAGTGAGTGTGTGGTGATGTGATGGTGATGATATTTACTTTCGTCTCTTTCTTCTTT
CTTTCTTTCTTTTTTTCTTTCTTTTTTTCTTTCTTCAATCCACTGACAACGCAGATCGGCCACCACTTGCTTCACTACCC
CCCCGGTCGAGCACCCTTCCACAAGGCGATCCTCGAATCGGGCGCGCCGACCGCGCGTGCCGTCATGGCGCCCGACCATC
CTCGGCCACGCGCACAGCTGCGTGCCTTTCTGGTCGAGGCAGCCGTGCTGGACGACGACGTGTTGGTGCCGCCGCCGCGG
GCCATCATCGACGCGCTGCGCGGGCTGTCAGCAGCAGCAGTGGTGCGGGCCAGCCGAGCGGTCTTTGCGCGCTCGCTCGC
CGGCGTGACCTGGCCTTTCCAGCCGGTCGTCGACGGGCTGCTAGGGCCGCCGGCCTGCGCCTCCCCCTACATCCGTTGCA
GTCCGGTCGACGGTTGGCGACAGCGACGAGCCCAGGCTCATGGACGCGCGTCCATGCCCGTCCTCACCGGCTTCAACACG
CACGAGGGTACCGCCTTTGTGCCGCGTGACGGTGTCCATGCCGACACGGATGCCGACTTCCGGGCCTTCTTCGCCAACCT
CATCCCCGGCCTCGACCAGGCCGATATGGACCTGCTCTGTCATCTCTACCCGGACCCGACGGCCGGCCACCACGAGACGG
ACGCTCGGCGGCTACCACCCGGCATCACCGGCCGCCAGTGGCCCCGGCTCCAGGCCGCTTACGCTCACTATGCCTACATC
TGCCCGGTCCTGCAGACGGCCCACCAGCTCTCGCTCGGCGCCGGCCAAGGATCGTCTGGCTCGGCGCCCGTGTACGTGTA
CGAGTTCGCAGCCCGCGCAACCGCCCTCGACACGGCCAACCATGGCGACCATGCGGCCGTGGTGGCCCATGAGGATGCCC
TGCTCGCCTACAGGCCCGGGCTGCAGCGCGTGTCCGAGGCCATGCACGCGGCTTGGGTGCGGTTCATTGCCAGTCCGGTG
GGCGATCCGAACGTGGAAGACGACAAGGAGGACGAGCACGAGCACGAGCACGAGGAAGACGAGGTCCGGACACATCGACG
CCAAAAACACCATCACAACCCTCTTCCACACTGGACCCCCTTTGTCTCGCCTCTCGCCGGCAACAGCGCCAAGACCAAGA
CCATCATGGTCTTTGGCCACGGCAACGACGAGCGCGTGCCGTCCGAATGCCGCCACGGCGGCCCCCAGGCCAAACCAGGC
ATCCCGGCCGCCATGCGTCGCCTCTCGGCCTTTGAGCTCGAGCAGTGCCGCTTCTGGTGGGACCGCGTCCACCTCAGCGA
GGGCTACGGCTACCGCTCCGAGACTGCCTTGGCCAGCCGGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62