GenePrediction:GLEAN_50 Details

Name: GLEAN_50
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:349741..351288 (+ strand)
Length: 1548
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:349741..349790 (+ strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_179:349951..350551 (+ strand)
Length: 601
Type: CDS
Source: GLEAN
Position: GCSC_179:350630..350691 (+ strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_179:351066..351288 (+ strand)
Length: 223
>GLEAN_50 class=GenePrediction position=GCSC_179:349741..351288 (+ strand)
ATGAGGCGGCTCATCCTCACCGGGGCCTGCTACCTCGACACGATCATCAGGTATGTTGTCGTCTTGCGAGCAAGTGGCCG
GCAGCGGGGCGAGAATGGTTCTTCTTTGGGTCGGGCGACCGACAAGAGAGGATACGAGTGTACGAGTGTCCGGAACGGCG
AGAAGGGATTGGCAGTGTCCTGACGATGCCCCCCGCTTCCTGGGTCACAGCGTCCCCTACTACCCGACAGAGGACACGAA
GCTGCGGGCAGCCAGCGTCCAGGTCCGCCGCGGTGGCAACTGTCCGAACACGCTCGAGGTGCTGCAGCAGCTGGTGGGGG
CAGAACCAGACGAGGCGGTGTCTGGCAGCAGCAGCGGCCGCGACGTCAGGGCCTACCTGGTCTCGTGTCTGCCGGCGGCC
GACGCGGCGGCCACGCAGACGATCCTCGCGTCGTTGGGAGGACCATCGAGTCCCTTTCTGTGTTTTGACCACTGCCTCTA
CCGCGACGGCTTCCAGGCGCCGGCTAGCTGCTACATCCTGCGGTCGGCAGCCACGGGCTCGCGCACGAGCGTCAACGACA
ACCGGCTGCCCGAGATGACGGCCGACGAGTTCGCCGGCGTGGTGGCGGCCGTCGGCGCGTCGTCGGATCCCGCATGGTGG
CACTTTGAGGGCCGCATCGCCGACGTCACGCTGGCTTGCATCGGCCACGTCCACCAGGCACGCCAGGCCGACGTCGTCGT
CAGCGTCGAGATCGAGAACCCGGACCGGCAAGGATTGCGGGCGCTGGCCGCCGAAGCTGACGTCGTGTTCTACTCTAAGC
TGTGGGCGCAGGTGAGACGGAGGAGAAGAGCGAACGAGCGAGCAGCCAAGCGTGACGAAAAGCTATCCACGTCGTGCTGA
TTACCACAGGGTCAAGGTTACGCAGATGCCGAGGCTTGTCTTCGTGGCGAGGCGGCATCGCTGCGTCAGGCGTAAGAAAC
CGCTTCCATATCCAGTCCCCCCTTTCGCATGTCTCCCTAACGTCTGCCTCCCAGAAAACTAGCTTTCTGCACATGGGGGG
CCCAAGGTGCCTCGGCCCTGGTCTGTGCCGGATCACACGTCTTTATCAGCCCCGTTCCATCGCCACTGCCGGCATCAAGC
GTGGTCGAGTATGGACAGCCCCTTCCCACTGCCGGTTGAAACGAGGAGAAAAGAGTGGAAAAAGAAAAAAGACGAGAAAA
AGGGAGAAGCAAAGAGAAAAAAAAAGAGAAAAAGAAAGAGAAAGAGAAAAAGGAACAACGGGAACCGGGAAAACGCCCCA
ATAGGCGAGAAATCGTACGTTGTTTGCTGACTGCTTTTCCTCTAGCTCCGTCGGTGCTGGTGATACGTTTGTGGCCGGCA
TCCTCTACAGGCTGGTCTGCCATCGAGAGGAGGCCGCATCAGAGGCAGCAGGCGACGGGCTGCAGCCAGCAACGACTTGG
AACCTGGATGACGCCAGCGTGCAGGAGGCGCTCGCCTTCGCCGTTGACCTAGCCACGCGCAAGGTCCAGATGGACGGTTT
CCGCGGCCTGGTGGCCCAGACGAGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62