GenePrediction:GLEAN_5100 Details

Name: GLEAN_5100
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1811200..1809593 (- strand)
Length: 1608
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1811200..1811160 (- strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_97:1811084..1809593 (- strand)
Length: 1492
>GLEAN_5100 class=GenePrediction position=GCSC_97:1811200..1809593 (- strand)
ATGGCCACTCTCCCGACAGCGGTGCGACCACTGGGCACATTGTGAGTCGTGCGTTGTCTCTCGGTCAATCATCGTGCTAA
TCATCGCAGCGAGCAGTTCTTCTCGTCGCGTCACAGTCTAGGCCTGCACAAGGGTGTCATCACGGTGTGTCGGTATGCGG
TGCCGACGAGTGTCGACGGCCAGCCACGGACGAAGGAGCAGGTGCGGGCGCGCGTGGAGGCGGCCGTGGCGGTCGTGATT
GGTCAGCTGGGAGCGCTGCGGACGGGGATCGCGGGCGAGGAGACACGGCAGCCGCAGTTTGTAGCGGTGGCCTCGGTGGA
CGTGCGAGAGCATGTGGAGTGGCGAGGGGGAGGAGAAGCCGAGGAGAAAGAGCTCGAACGCCAGCTAGAGGACGAGTGTG
GACGGTCGTGGCCCGACTTGGAAACACATCCGCCATGGCGGCTGCTGGGCTTCAACCGTGATCCTGACGACCGGCCGCAA
CACATCGACCTCGCCTTTGCCGCACATCATGCCTTGGCCGACGGAAAGAGCGGCCAGGTGTTTCACCGGTTTCTGGTGGA
AGCGCTGAACGAGGGCGAGACGATGGGCGAGATCGACAGCGAAACGAATACACCAACCAAAACCGACAGCACGGCCGTCC
TCCGATTCGACAACGTTCCCTTGCTGGCGCCACCACAGGAGCAGCTCGTCCGCTTTACCGTCTCGTGGGGCTTCTTTGCG
CGCACGCTGTGGAACGAGCTGGGACTGGCCTGGTTGAAGCGGGCGGTGGCAGCAGTCCTAGGAAGAGGAGAGACGTCGTC
TGCGCCTGTTCTCTACACGGGCGACCAGCCGATCCGTCTGGTGCTGGGCCGCACGCGCGTGTGCCTCCTCTCGGTGGCGC
CGCCTGACCTGGCCGCCCTTCTGGCCGCCTGCCGCGTGCACGGCACCACGCTGACGCCACTGTTGCACGGGCTGCTGCTG
GTGGCGGCAACAGCGGCTCGCCGGAAGATGCCCTTGGCTGGCGCGACAACGACCTTTTCGGGCACGACGCCTATTAGCTT
GCGGGGTCACGTGACCCAACCCAAGCCGCAGCTAGACATGAAGCGGACCATGGGCAACTATGTGTCAGCGTACCGACACG
TGTTCAGTCGAGGGGCAGTGCAGGTTCTGGAAGACGCTCCGGTCGTCGGAAGCCACCCCGACGCGGCCCTCTGGGAGGCC
GTGGCCGAAGTGGACGTCGGACTGCGGGCCTGCACGGCCGACGTGACGCGCGACAGCGTGCTCGGGCTGTTGGCGTGGGT
GCGTGACTGGCACGGCTGGTTCCGTGGAAAGGCCGGACAGCTGCGCGACGACACGTGGGAGGTGTCCAACGTGGGGACGA
TGGACAACAACAACGACAACAACAGCGGCGGCTGGCACCTCACGCGATCCCTCTTCGTCTTCACGGCTCCGGCGACGGGC
CCGCTGCTGGAGCTCACGGCGGCCAGCGTGCATGGCGGACCGCTGACGCTGGCGTTGGTGCGACAGCAGGGCAGCCCGGC
AGAGGAGCAGTTCTGCGAGGAGGTCTGGGCCGACGTGAAGACGAGCCTGTGGCGGTTTCGCCACAGCGGACGCTTTATGG
GGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62