GenePrediction:GLEAN_5101 Details

Name: GLEAN_5101
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1809347..1808464 (- strand)
Length: 884
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1809347..1809110 (- strand)
Length: 238
Type: CDS
Source: GLEAN
Position: GCSC_97:1809032..1808464 (- strand)
Length: 569
>GLEAN_5101 class=GenePrediction position=GCSC_97:1809347..1808464 (- strand)
ATGGCCGCCCTGCACGCAGCAAGCTCCCCGGCCTGTCTCCGCTGTCTGGCACGACGGATGCTGTCACGGCCGGCTGTCCT
TGGCATGGCCTCTGGCAGCAACAACAGCAGCAGTCTGCTGACGCTGACCTCGACGACGACGACAACGGTGCAGACGCGCG
GAAAGAAGACGGGACGACGTGGTGACAATGGTGTGGTCGTGCGGCTTCTGCAGGACGTGGAACAGTTTGGACAAAAGGGT
GCGTGTTTGTGTGTGTTTGCGTCCTATTTTCTTCATCTGTCTCGCCATCATTCTCCCTCCTTCTGACATTGACAGAAACG
ATCCTCCGGATCGACCGTGGCCGCATGCGTAACCTCTGGTATCCCCGCGGCATAGCCGACTATGTCACGACGGCCGGCCA
AGCCGTCTCGGAGCGCGACCCCTTCTTTGGCGTTGCCGGCAGCAAGCCCGACGAGGACGTCGCTTCTTCTGCTCCGGCCG
CCACAGCCCACGCTGCTCTCCTGCCGACCGTCGATGCTGCCCGTGCTGCCGCTCTGCTCGATCGCCTGCCACCGCTCGTC
TTTGCACGCCGACCCATCACGGCTGCCTCGACCGCCATCTTCGGGTCCGTCTCGGCCGACGACGTCGCCACTGCCCTGCG
CGCTGCCCTGCACGCTGTCGATGACGGCAGCAGCGACGAGACCGGCCGCCTTCGCGTCGAGGGCCGTGATGTCCGCTTTG
TCGTCGACGGCGAGGCTTTCGGTGATGCCGCCTCCTCTTCGGAGGCCGAGGCTACCGCCGATCGCGTCAAGGCGCTCGGC
CGCTGGGAGGTCGAGATCGCCGTGCGCGGCGGCGGCGTCGCCACTGCTCCGGTGCGCAAGATCATCGAGGTGGTGGCCCA
GTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62