GenePrediction:GLEAN_5102 Details

Name: GLEAN_5102
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1803442..1802483 (- strand)
Length: 960
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1803442..1803118 (- strand)
Length: 325
Type: CDS
Source: GLEAN
Position: GCSC_97:1803042..1802483 (- strand)
Length: 560
>GLEAN_5102 class=GenePrediction position=GCSC_97:1803442..1802483 (- strand)
ATGATTGGCAGTAGGGTCGTAGGGTCTCGCGGAAGCAGCGAAGCAGTGCGCCGTGACGACGCCACACATGTGAAACCCCA
GCCACACCTCGTCGATCGCTGCTTCTTCGCGTCTTGTGATGCCAGCACGCGACAGCAAGTCCCGGCCGGCAGAAGATACA
TGGCGATGGATGAGCCGCGCGACACGCCCATGGGCGATGCGGACGCCGTCGTGCCAGACGCGACCACAGCACTGGTCCTC
TCCGAAGACGAGCAGCGCGTGCTAGCGCTCTACGACCGTCTACGGGAGCTGCAGCTGCAGATTGCGCTGCTCGGGGCACA
GAAAGGTGAGGCTGAAGGAGGGATGAGGCAAAGAGAGGCACGGCCGAAGGACCGGTTCGTGCTAACCCGCTCTGCTGCAG
ATGCACCCCATGACCATAATGACGACGACGACGACGACGACAATAACAACCTCGAGGCTGCCCGCGACCGGCTGCTTGAT
GCCCGTGCCGCCTATGTCCTCCGCAATGAAGTCATCGACAGCGTCTTGTCCGTCAACCCCGTGCTCAAGGCCGTGCACGG
CGCCACGCGCGCGTCGCCCATCGAGCGCGACCTGCTGCCGGCCGTCGAGCAGCGCGATGACGCGTCGCAGGCCGTCGCAC
AACAGGCCGGCGCACGACGAGCCGTCCTAGAAAGGCATGTTGCCGTGGCTGCCGAGAGCTGCCGGGTCCGACGACAGAAC
CAGGCGCTCGCTGAGCAGCTGCATAGGCAGCTCGCCGAGGCCGTCGAGGACGATAGCGCGGGGGGCGACAAGAACAACGA
CACACATGACGACGAACTCACCCAGCTGCAGCAAGAACTAAAGGCCAGCCGTCAGCGCTGGAAGCTCATCAAGGGCACGG
CCAGCGCGGTCGTGGTCGGCAGCGGCGTCGACTGGGCGCGGGACCCAGAGCTACAGAACCTCGTCTTGGACCCAGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62