GenePrediction:GLEAN_5103 Details

Name: GLEAN_5103
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1799428..1799025 (- strand)
Length: 404
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1799428..1799368 (- strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_97:1799312..1799095 (- strand)
Length: 218
Type: CDS
Source: GLEAN
Position: GCSC_97:1799030..1799025 (- strand)
Length: 6
>GLEAN_5103 class=GenePrediction position=GCSC_97:1799428..1799025 (- strand)
ATGGTCAAGGCAGCAACTAAGGTCAAGACCGGCAAGGTCGAGAAGCGCCGCAGCAAGAAGGGTATGTCTATTGATCAATC
TCCATGCATCGCCAGGCTGGGCCGCTGACGTCGCAGATCCCAACGCCCCGAAGCGCGGTCTGTCTGCATACATGTTCTTC
GCCAACGAGCAGCGTGAGAACGTCCGTGACGAGAACCCTGGCATCTCGTTCGGTCAGGTCGGCAAGATCCTGGGTGAGCG
CTGGAAGGCTCTGAACGAGAAGCAGCGCACCCCATACGAGGCCAAGGCTGCTGCTGATAAGAAGCGGTACGAGGACGCCA
AGGCAGCCTATAACGTGAGTACCCCAATAAATTTGCAGACTCAATTCTGCACTGGACAGACTCGCTAACATCCCACAGGC
GTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62