GenePrediction:GLEAN_5104 Details

Name: GLEAN_5104
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1796843..1794486 (- strand)
Length: 2358
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1796843..1796362 (- strand)
Length: 482
Type: CDS
Source: GLEAN
Position: GCSC_97:1796294..1796218 (- strand)
Length: 77
Type: CDS
Source: GLEAN
Position: GCSC_97:1796155..1796070 (- strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_97:1796010..1795940 (- strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_97:1795747..1795515 (- strand)
Length: 233
Type: CDS
Source: GLEAN
Position: GCSC_97:1795442..1795367 (- strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_97:1795279..1795152 (- strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_97:1795081..1794486 (- strand)
Length: 596
>GLEAN_5104 class=GenePrediction position=GCSC_97:1796843..1794486 (- strand)
ATGATGGCCATGATACATGAAAACAGTTTCATGCCAGAGAGCAATTATGATGCGCCAATCGACCTTAGCCGCGGCCCCAA
AATTTCCGCCAGCTGCTTGAACGAAGCCGTAGGGGCCGACATCACCGCAGGGCTACTGGACAACTTGCGCGGCTTCCTTG
ACCAGTCGCTACAGCCTCACATGATAATATTGGCCGATGGGCTCCGACAATGTGGATGTCTGCTTCGCGAACTGGTTGGC
TGTTGCAACACGAATTATGCCCGCCTGCCCGTAACGCTAGACTACATCGAAATAGTCCTGCCGAGTTTGCGCTGCACGTT
TGTGAAAATAAAGGCCTACTATGATGATCCAACTCTTACCATGGACATGCGGTGGCGCACCATGTACCATAGGATGACCG
AAGAGGCGGATGGCCTTCCGCTGCCTCAGAGGGCTGGCCTGTACAATCAGTACTTGCTGTGCCTGCAGCAGATGCAGACT
CGGTAGGTTCTACGGCTTGCAGCTCTCCTCGTCGGCCTGGCTAACCAACTCGGCTCTCTGTCGGCATAGTTCGCAATACT
TTGACATGAACACCCTCGAGGCTCTCCGGGACCGAATTCTCAAGCTGCGAGAGAAGCAAGGAATCGGTACGCAATCCGCA
AGATACTTCCGCCCATGAAAGGGGTCCGTCGACAGCTAACAAAAGCAGCACCGCCACCGCCGCCGCAACCGACCCAAGCA
GGTGCCCTTATTCTGGCATCAATGCAGACAGTCCCTTTGTCTGTTGTCGACCGAGTGCGTCGAACACATAACTATTGGCT
AATGCGCACTCTGTTGCTAACTTGCTTTGGTAGAACATTCACTGGGCTGAGGAGATTTTCACAAGGCCGCTACCTTGCCG
CACCCCCCTCAAGCACCTGAACATGTTTGTCATCTCCGGTCCCCGTTGCTACATTGTTTAAATACTGAGATGTCTGGCTG
TTCTAGGTCTCTGTGCTACGGTCCATGGTCGAATTTCCGCATGCCGCCCAAAGCCAAAATTCTCTGTCGAAGGTACGATA
ATTTGCAATATGATGCACTGGTGTAGATAATGTCTTTACTGATATACGCTACGCAGGTGGTTTGACCAAGCCCGCTTGTC
ACTTATTGTTTTCGAGTACCCTGGCGACGAAGCGCCCTTCATAGCCATCCGCAGCCTGCACCTTGGAACCAACACTCCGC
TCATGTCCGTTCGTGGCATTCACGAGCTGTGCATCTCACGAGACGGCAGTTGTCTTGTGCTCAAGCGCTGGAGCCAGAGC
GAAGGCTGCAGCAAGCTATGGGCAGTCTTGTACTTTATCACGTGGGAGGGTGAGTGTTGTCCCCTATATCTCGTCATTCG
AGACGTGTCGTGTGCTGTAGCAGGAGCTGACATCTGTATAGAAATGGTGCTCTTTCATTGCACATTTGTTGCACTCAAGT
CCCAGTGCTACCGTACGCGGCAGATCAAGCCAGAAGAGTTCAAATTGAGCCGCGAGAAGAGAGACTTTCAAGCGTAATCA
TCCCCTTTCCGCTTTCACCCTAATAACAGCTAACCAGGCCACAGTCGCATTATCGACGATGGGTTTAAGCACTCTCTGAT
CGTCTATCGTGACACCGAGTCGCATAGCATCCGTCTCCACGCTGCTGTCTGGGAGGGCGAGATGCGCCAGTGTCCCGTAT
GGACAGCCTTTGGTAGGTTTTCTGTTGGCTTGAAATGGGCTGCACTGCTCATGTACTGGAACTGACTTTTGGTTCAATGC
AGTCACCAATCAGGCCAGGTCGTCCTCATGGCTCCGCCGCAAGGGCAGACACCGAGTCTGGCTCCGGGACGTGCAGCTGT
ATGTGTTCTGCAACATCTACCGCGAGGACCACATGCGCCAGAACAAGTCGGGCGCGTTCGAGATCGACTTCGCCAGCGAG
GAGGCTGCACGGCGCTTTGAGGAGGTGTTTTACCCGCCGCCGCCGCCGACTCCACAGGCTTCGCTTGGCTCGTCAGCGGT
GCCGCTGGCCGTGACAGCCGGCTCGGATTTGCATAGCGGCAGCAGCTCGGGAAAGTCATGTCGGCCGATGTCGGTCTCGA
GTTTGTCGGAGGGCTCAGCGGATGGATCGGCCGAGGGTTCGGACAACCAGTCAGCTCCGGAGTCTATGGCAGGGTCTTTC
ATGGGGTCCGAGCAGGGATCTGTGCAAGAGTCTGTGCCGGAGTTTATTCCCGAATCCAGCCCCGACTCCACGCCAGGCTC
GACAGAAGACTCTGCAGATGTGACGGACTTGACAGATTCCCTCGGCTCGGTAGCCCTGGCCGATTCGACAGATGCGTCCG
AAGTGACCGAGATGAAGCCGCCCACAGACCACGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62