GenePrediction:GLEAN_5106 Details

Name: GLEAN_5106
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1787533..1785505 (- strand)
Length: 2029
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1787533..1787224 (- strand)
Length: 310
Type: CDS
Source: GLEAN
Position: GCSC_97:1786853..1786213 (- strand)
Length: 641
Type: CDS
Source: GLEAN
Position: GCSC_97:1786119..1785505 (- strand)
Length: 615
>GLEAN_5106 class=GenePrediction position=GCSC_97:1787533..1785505 (- strand)
ATGAGCAGAATGGGACATTCTTTGCCAACCGCCGACTATGGACAACAGCAGTACAATCCAGGAACCACCTCGCATTCCGC
TGCATCAGTTTCGCACTACACCCAGGCTCAGATGGGTGGTCAGCCTTTCTACATGACCCAGGCTCCTCTAATGCCAAATT
CCCCATATTACGGAAGCCCTATGTCGGCGATGAGCCAACAAGGACAGGTCATGACACAGCAAAATGGGTTTGCCTACTAT
CCCGGCCAGGTGCAGCCGATGGCACCGTACCAATATTCTCAACACTCGCAGTATCCGAGTCAGAACAAAGGTACACACAA
CTACGGATGCTTTGTATATTTTCCACCACCTAACGCCTTCCAAGCACAGCCCAGGATATCGGCTCAACCCATTGTGGTCT
CGTCCAATGCGCCGTATACGCAACGGACAGTTCAAAGACAGCAACAGAAATGTAGGTTGTGTAGTAACACTTCGCTTTCT
CTCCTAGCTCAAATTGGTGAACATGATGTACTAATGGAACCGATTAGCTCAAGGTGAAAACAGAGCAAGCACCGTAGTGC
GTGGCCCTCCAAGAAAACCGAAACAAAGCGGTAAGAAAAGCATATTATTCTCTTCCTTTTTTTGCGATCGTCAACTTCTA
TTGGTTGCAGATGCATACACGGAACTGATGTCTCGTTCAGGACACGCTATCTGGATCGGAAATTTGCCTCCTCAGACAAA
CTTGATGGAACTAGTCCAACACGTTTGCAAGCATACAGAGGACTTGGAGTCTCTGTTTCTCATATCGAAGAGCAACTGCG
CCTTTGCGAACTTTAAAGACGAGTCGAGCTGCATAGAAGCGCAGCAAAAAATCAACGACACCCGATTCATGTCCGTCCGT
CTCGTCAGCCGCCTCCGGAAAAATGTGGTCGACGTGGCACAGGGAATGATTCCACCAACGGGACCGGCATCATTAACAGC
AGCTCCGCAACCCCTGGTACAGCAACAGCAGCAGAACCGGAGCCATGTGAGCACCCCGGAGGCCAAGGACGGAGACGCGG
ATGAAGAGGAAGACGGGGAGGAAGAATCGCCTGCAGAGGAAGCCGGACTAGATAATACCTGGGCATCTTCGACCGACATT
AGCGCTACGACTTCCGTCAGCACAACGATAGCTTCGTCGCCTGCGGCAAAGGCCGAGATCGCAGATGGTCCGGAAGTGCG
CTCGAAGGACAGATTCTTCATTTTGAAAAGTCTCACGGTGGAAGATCTGGAATCAAGCATGCGGACTGGCATCTGGGCGA
CACAATCACACAATGAAGAGACGCTGAACAGTGCTTTCAAGGTTTGTGTTTTGCTTTGTCAAATCCTGTCAATTCATTGC
TTCTCCTGTTCGCTTATTCCAAACTTGGCGAGCTAACATGCTGTCTTTCTGCAGAACTGTGACAACGTGTACTTGATATT
CTCAGCCAATAAATCGGGCGAGTATTTTGGCTATGCCAGAATGACATCGGAGATTAACAACGATCCGGCAGCGGCCATCG
AGTTTGCACCAAGGGCGCAATCTTTCAGCGACGAGGACTATCCAAAAGCCATCCCTACCGAGGCGACAGACTTCGCGCCG
CCAGGTCGTATCATTGACGACTCAGCCCGAGGAACAATATTCTGGGAAGCACAGCGAGATGATGCACCCGAAGCTGCGAC
AGCTGCTAACGGGACAGAGGACGGTTCGGTCACGGCTAGCGACGGGGCAGACGAGGTGAGCAGCGTGAAGAGCGGCGGGC
TGCCAGAAGGTGCTGGCGAGGCACAGACGTGGGGGAAGCCGTTCCAGCTTGAGTGGCTGTCGACATTGAGGGTGCCGTTC
TACCGCACACGGGGAATGCGCAATCCTCTGAATGCCAATCGGGACATCAAGATCGCTCGTGATGGCACTGAGGTGGACCC
GACCGTAGGACAACGACTCATCGGACTCTTTCACCAGCCGCTGGTGGTGTCTGGCACATCGGGAAGAGGCACCAGTTTTA
CTGCATATACGGCAGTTCTGATGGCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62