GenePrediction:GLEAN_5108 Details

Name: GLEAN_5108
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1783408..1781664 (- strand)
Length: 1745
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1783408..1782900 (- strand)
Length: 509
Type: CDS
Source: GLEAN
Position: GCSC_97:1782835..1782750 (- strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_97:1782686..1782319 (- strand)
Length: 368
Type: CDS
Source: GLEAN
Position: GCSC_97:1781834..1781664 (- strand)
Length: 171
>GLEAN_5108 class=GenePrediction position=GCSC_97:1783408..1781664 (- strand)
ATGTGCGTCGAAAATCGGCCTCTCCGCCGAAGCGGAATCCGGGGCCGAATTACTATACCTTGCAGACAGATAAAGAGCAG
CGACGACCTCGACATCGGCCTCGACGTCTTGCCACCCGCTGCTCCCAATATGTCCAGCCAGCTCGCCGACGCCGCCGAGG
CTGGCTTTCACGATGCCGGGGCCTATGACGCATATCGGCCCTCGTACTTACCGGCTATTGTTGACAGCTTCCTTTCGCGG
CTAGAGGTGCCGGCGACTGACGCGAAAGAGATCCGCCTCGTGGAGATTGCTGCCGGCACTGGCAAGTTCACGGAGGCGCT
CTCACGGCTGGCTGCCTCGTCCAGCATCCCGTGGTCCATCATTGCGGTCGAGCCTCACGACCAGATGCGCGGCCAGCTGG
CGGCCAAGAGCCTGCCACACGTCACCGTCATCAAGGGCCATGCGGCTGCCGTACCGTCGGTGGCTGCCGGGTGGGCCGAC
GCGGTCATCAGCGCGCAGGCTTTCCACTGGTGGGCATATCTCTGTCTTGTTCCCTGCCCTGCTGTCTTGCCTGCTGTTCT
GACGGCTTTGCAGGTTTGCAAACCAGGATGCGTTGCGCGAGATATGGCGGCTCCTGAAGCCCAACGGTCTGGTCGGCGTC
GTCTGGAACATTGAAGACTGTCCGCGTGTCCTGTTCCCACGACCATGATGTATTCTTGTTCTATATGCTGACGTTCCCAC
AGACAACAAACCCCAAGACTGGCCGGCGTCGACGCCCTGGGAGCAGCGCGTCAACGACCTTGTCTACGCGCTGGGCGCAG
ATGGCAACGCCCGGTTTCGCAACTGCCGCTGGCAGGCTGCCTTTATCGAGGCGGCCTCGGCAACACCGCCACTGTTTTCA
CCTCTGGCAGACGACCGCATCCGATGGTCGGTACAGCTGACGCCAGACGCGCTGTTCAAGCGGCTCCTGACGCTCAGCCA
GGTGGCCAACCTGCCCGAGAGCGACGACGACGACGATGGCAGCGAGAGGCCGGCTAGCCGGGGAGCGTTTCGGCGGCGGC
TGGATGCGATCGTACACGATGTTGAGCGCAACGCTGCTGGCGAGCTGACGGTACGCGCAATGACGTATTATGCGTGGGCG
CGACGGATGTAAAAGGCCGATGCCGACTCTTGCACAGCACAGTTTACAATGGTCACAGGGAAGCCAAAACAGGAAGCAAT
ACAGAAGAATGTGCAATTCGCTGGCATTGCTGCATTTGTTCGATACAAGTATTTTATGGCCCATGTCTGGCGCCACTGTG
GCAACGTGCAGTGCTGTCTGATAGCTGCCATCATTCGTCTGCCGAAATATACATGACTGTGATTGTCAGCATGCGCACGA
AACCAGATCACGGACTCTCGACTCACCGTTGTTGCCGCGCACAAAGGCGTCACCGTACGTCCTCCGCTTGACGCCGTTGA
CATACTCTGCCGTCTTTTCCAACGCAATGTTCATGTAGCCGTCGACCGATTGCAGCTCGCCTGCAACGTTGTCAGCATCG
GTTGGGCATACTAGGGGGGGAACGCCTCGCTAACCCTTGTACACGACACCCGAGTTCAGCTTGACAACCACCGGGCTGCC
AATGATCTCGCTGAGGAAGGCGCTGGGGTCTGTGCCCTCGGCCTGGCTGCCAGCCGTGCCGTTCTCCATGGCGCAAGAGG
GCAAAGGGAGTCGATGGAGGGTAATAGAGGAGCTGGTTCGTCGACAGTTCGGCTCAGAGAGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62